Regulog PaaR - Mycobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Phenylacetic acid degradation |
| Effector: | Phenylacetyl-CoA |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Mycobacteriaceae
- By trascription factor - PaaR
- By TF family - TetR
- By effector - Phenylacetyl-CoA
- By pathway - Phenylacetic acid degradation
| Genome | Genes | Operons |
|---|---|---|
| Mycobacterium abscessus ATCC 19977 | 13 | 4 |
| Mycobacterium smegmatis str. MC2 155 | ||
| Mycobacterium tuberculosis H37Rv | ||
| Mycobacterium avium 104 | ||
| Mycobacterium marinum M | ||
| Mycobacterium leprae TN | ||
| Mycobacterium flavescens PYR-GCK | ||
| Mycobacterium vanbaalenii PYR-1 | ||
| Mycobacterium sp. JLS |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| paaZ |
*
Mycobacterium abscessus ATCC 19977 Site: position = -108 score = 4.8959 sequence = ACTGACCGTTCGGTCGGCCACA Site: position = -35 score = 5.42127 sequence = ACCGAACGAATGGACGGTTGGT Gene: MAB_0900c: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
|
|
|
|
|
|
|
|
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
| ethD |
Gene: MAB_0899c: Possible ethyl tert-butyl ether degradation protein EthD |
|
|
|
|
|
|
|
|
Possible ethyl tert-butyl ether degradation protein EthD |
| CRON 2. | ||||||||||
| paaA |
*
Mycobacterium abscessus ATCC 19977 Site: position = -37 score = 6.13347 sequence = AATAACCGAACATTCGGTCGGT Site: position = -33 score = 4.50201 sequence = ACCGAACATTCGGTCGGTAATC Gene: MAB_0906: Phenylacetate-CoA oxygenase, PaaA subunit |
|
|
|
|
|
|
|
|
Phenylacetate-CoA oxygenase, PaaA subunit |
| paaB |
Gene: MAB_0907: Phenylacetate-CoA oxygenase, PaaB subunit |
|
|
|
|
|
|
|
|
Phenylacetate-CoA oxygenase, PaaB subunit |
| paaC |
Gene: MAB_0908: Phenylacetate-CoA oxygenase, PaaC subunit |
|
|
|
|
|
|
|
|
Phenylacetate-CoA oxygenase, PaaC subunit |
| paaD |
Gene: MAB_0909: Phenylacetate-CoA oxygenase, PaaD subunit |
|
|
|
|
|
|
|
|
Phenylacetate-CoA oxygenase, PaaD subunit |
| paaE |
Gene: MAB_0910: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
|
|
|
|
|
|
|
|
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
| paaK |
Gene: MAB_0911: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
|
|
|
|
|
|
|
|
Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
| CRON 3. | ||||||||||
| paaR |
*
Mycobacterium abscessus ATCC 19977 Site: position = -92 score = 6.15351 sequence = AATAACCGATCGTTCGGTCGGT Site: position = -88 score = 4.67361 sequence = ACCGATCGTTCGGTCGGTTGTC Gene: MAB_0901c: Transcriptional regulator of phenylacetic acid degradation, TetR family |
|
|
|
|
|
|
|
|
Transcriptional regulator of phenylacetic acid degradation, TetR family |
| CRON 4. | ||||||||||
| paaJ |
*
Mycobacterium abscessus ATCC 19977 Site: position = -48 score = 4.67361 sequence = GACAACCGACCGAACGATCGGT Site: position = -44 score = 6.15351 sequence = ACCGACCGAACGATCGGTTATT Gene: MAB_0902: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
|
|
|
|
|
|
|
|
Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
| paaF |
Gene: MAB_0903: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
|
|
|
|
|
|
|
Enoyl-CoA hydratase (EC 4.2.1.17) |
| paaH |
Gene: MAB_0904: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
|
|
|
|
|
|
|
|
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
| paaG |
Gene: MAB_0905: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
|
|
|
|
|
|
|
Enoyl-CoA hydratase (EC 4.2.1.17) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |