Orthologous regulated operons containing paaK gene

Properties
Regulog:	PaaR - Mycobacteriaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Actinobacteria

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Mycobacterium abscessus ATCC 19977
Position: -37 Score: 6.13347 Sequence: AATAACCGAACATTCGGTCGGT Position: -33 Score: 4.50201 Sequence: ACCGAACATTCGGTCGGTAATC Locus tag: MAB_0906 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: MAB_0907 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: MAB_0908 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: MAB_0909 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: MAB_0910 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: MAB_0911 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaA-paaB-paaC-paaD-paaE-paaK	-37	6.1	AATAACCGAACATTCGGTCGGT	MAB_0906
	-33	4.5	ACCGAACATTCGGTCGGTAATC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --