Regulog CzrA - Listeriaceae
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance |
| Effector: | Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+) |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Listeriaceae
- By trascription factor - CzrA
- By TF family - ArsR
- By effector - Zinc ion, (Zn2+)
- By effector - Silver ion, (Ag+)
- By effector - Nickel ion, (Ni2+)
- By effector - Copper ion, (Cu2+)
- By effector - Cobalt ion, (Co2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Zinc resistance
- By pathway - Nickel resistance
- By pathway - Copper resistance
- By pathway - Cobalt resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Listeria innocua Clip11262 | 4 | 1 |
| Listeria monocytogenes EGD-e | 4 | 1 |
| Listeria seeligeri serovar 1/2b str. SLCC3954 | 4 | 1 |
| Listeria welshimeri serovar 6b str. SLCC5334 | 4 | 1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| czrA |
*
Listeria innocua Clip11262 Site: position = -42 score = 6.52468 sequence = CATATGAATATATGACCATATA Gene: lin2636: Transcriptional repressor of multiple metal-sensing, ArsR family |
*
Listeria monocytogenes EGD-e Site: position = -43 score = 6.83625 sequence = CATATGAGTATATGAACATATA Gene: lmo2493: Transcriptional repressor of multiple metal-sensing, ArsR family |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -43 score = 6.54304 sequence = CATATGAGTATATGAACATGTA Gene: lse_2393: Transcriptional repressor of multiple metal-sensing, ArsR family |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -43 score = 6.83625 sequence = CATATGAGTATATGAACATATA Gene: lwe2441: Transcriptional repressor of multiple metal-sensing, ArsR family |
Transcriptional repressor of multiple metal-sensing, ArsR family |
| lin2635 |
Gene: lin2635: Hypothetical protein |
Gene: lmo2492: Hypothetical protein |
Gene: lse_2392: Hypothetical protein |
Gene: lwe2440: Hypothetical protein |
Hypothetical protein |
| czcD |
Gene: lin2634: Cation efflux transporter |
Gene: lmo2491: Cation efflux transporter |
Gene: lse_2391: Cation efflux transporter |
Gene: lwe2439: Cation efflux transporter |
Cation diffusion facilitator family transporter |
| csbA |
Gene: lin2633: Hypothetical protein |
Gene: lmo2490: Hypothetical protein |
Gene: lse_2390: Hypothetical protein |
Gene: lwe2438: Hypothetical protein |
Hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |