Regulog CzrA - Listeriaceae

Properties
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector:	Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By trascription factor - CzrA
By TF family - ArsR
By effector - Zinc ion, (Zn2+)
By effector - Silver ion, (Ag+)
By effector - Nickel ion, (Ni2+)
By effector - Copper ion, (Cu2+)
By effector - Cobalt ion, (Co2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Zinc resistance
By pathway - Nickel resistance
By pathway - Copper resistance
By pathway - Cobalt resistance
By pathway - Cadmium resistance

Statistics of regulated genes
Genome	Genes	Operons
Listeria innocua Clip11262	4	1
Listeria monocytogenes EGD-e	4	1
Listeria seeligeri serovar 1/2b str. SLCC3954	4	1
Listeria welshimeri serovar 6b str. SLCC5334	4	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
czrA	* Listeria innocua Clip11262 Site: position = -42 score = 6.52468 sequence = CATATGAATATATGACCATATA Gene: lin2636: Transcriptional repressor of multiple metal-sensing, ArsR family	* Listeria monocytogenes EGD-e Site: position = -43 score = 6.83625 sequence = CATATGAGTATATGAACATATA Gene: lmo2493: Transcriptional repressor of multiple metal-sensing, ArsR family	* Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -43 score = 6.54304 sequence = CATATGAGTATATGAACATGTA Gene: lse_2393: Transcriptional repressor of multiple metal-sensing, ArsR family	* Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -43 score = 6.83625 sequence = CATATGAGTATATGAACATATA Gene: lwe2441: Transcriptional repressor of multiple metal-sensing, ArsR family	Transcriptional repressor of multiple metal-sensing, ArsR family
lin2635	Listeria innocua Clip11262 Gene: lin2635: Hypothetical protein	Listeria monocytogenes EGD-e Gene: lmo2492: Hypothetical protein	Listeria seeligeri serovar 1/2b str. SLCC3954 Gene: lse_2392: Hypothetical protein	Listeria welshimeri serovar 6b str. SLCC5334 Gene: lwe2440: Hypothetical protein	Hypothetical protein
czcD	Listeria innocua Clip11262 Gene: lin2634: Cation efflux transporter	Listeria monocytogenes EGD-e Gene: lmo2491: Cation efflux transporter	Listeria seeligeri serovar 1/2b str. SLCC3954 Gene: lse_2391: Cation efflux transporter	Listeria welshimeri serovar 6b str. SLCC5334 Gene: lwe2439: Cation efflux transporter	Cation diffusion facilitator family transporter
csbA	Listeria innocua Clip11262 Gene: lin2633: Hypothetical protein	Listeria monocytogenes EGD-e Gene: lmo2490: Hypothetical protein	Listeria seeligeri serovar 1/2b str. SLCC3954 Gene: lse_2390: Hypothetical protein	Listeria welshimeri serovar 6b str. SLCC5334 Gene: lwe2438: Hypothetical protein	Hypothetical protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CzrA - Listeriaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --