Regulon of CzrA in Listeria welshimeri serovar 6b str. SLCC5334

Properties
Regulator type:	Transcription factor
TF locus tag:	lwe2441
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector:	Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Regulog:	CzrA - Listeriaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By trascription factor - CzrA
By TF family - ArsR
By effector - Zinc ion, (Zn2+)
By effector - Silver ion, (Ag+)
By effector - Nickel ion, (Ni2+)
By effector - Copper ion, (Cu2+)
By effector - Cobalt ion, (Co2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Zinc resistance
By pathway - Nickel resistance
By pathway - Copper resistance
By pathway - Cobalt resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 6.8 Sequence: CATATGAGTATATGAACATATA Locus tag: lwe2441 Name: czrA Funciton: Transcriptional repressor of multiple metal-sensing, ArsR family Locus tag: lwe2440 Name: null Funciton: Hypothetical protein Locus tag: lwe2439 Name: czcD Funciton: Cation efflux transporter Locus tag: lwe2438 Name: csbA Funciton: Hypothetical protein
	lwe2441	czrA	Transcriptional repressor of multiple metal-sensing, ArsR family
	lwe2440		Hypothetical protein
	lwe2439	czcD	Cation efflux transporter
	lwe2438	csbA	Hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD