Regulon of CzrA in Listeria welshimeri serovar 6b str. SLCC5334
| Regulator type: | Transcription factor |
| TF locus tag: | lwe2441 |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance |
| Effector: | Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+) |
| Regulog: | CzrA - Listeriaceae |
| Statistics of regulated genes: | |
| - Genes | 4 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Listeriaceae
- By trascription factor - CzrA
- By TF family - ArsR
- By effector - Zinc ion, (Zn2+)
- By effector - Silver ion, (Ag+)
- By effector - Nickel ion, (Ni2+)
- By effector - Copper ion, (Cu2+)
- By effector - Cobalt ion, (Co2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Zinc resistance
- By pathway - Nickel resistance
- By pathway - Copper resistance
- By pathway - Cobalt resistance
- By pathway - Cadmium resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -43
Score: 6.8 Sequence: CATATGAGTATATGAACATATA
Locus tag: lwe2441
Name: czrA Funciton: Transcriptional repressor of multiple metal-sensing, ArsR family
Locus tag: lwe2440
Name: null Funciton: Hypothetical protein
Locus tag: lwe2439
Name: czcD Funciton: Cation efflux transporter
Locus tag: lwe2438
Name: csbA Funciton: Hypothetical protein |
|||
|
czrA
|
Transcriptional repressor of multiple metal-sensing, ArsR family
|
||
|
Hypothetical protein
|
|||
|
czcD
|
Cation efflux transporter
|
||
|
csbA
|
Hypothetical protein
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |