Regulon of CzrA in Listeria innocua Clip11262
Regulator type: | Transcription factor |
TF locus tag: | lin2636 |
Regulator family: | ArsR |
Regulation mode: | repressor |
Biological process: | Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance |
Effector: | Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+) |
Regulog: | CzrA - Listeriaceae |
Statistics of regulated genes: | |
- Genes | 4 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Listeriaceae
- By trascription factor - CzrA
- By TF family - ArsR
- By effector - Zinc ion, (Zn2+)
- By effector - Silver ion, (Ag+)
- By effector - Nickel ion, (Ni2+)
- By effector - Copper ion, (Cu2+)
- By effector - Cobalt ion, (Co2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Zinc resistance
- By pathway - Nickel resistance
- By pathway - Copper resistance
- By pathway - Cobalt resistance
- By pathway - Cadmium resistance
Locus Tag | Name | Function | |
---|---|---|---|
Position: -42
Score: 6.5 Sequence: CATATGAATATATGACCATATA
Locus tag: lin2636
Name: czrA Funciton: Transcriptional repressor of multiple metal-sensing, ArsR family
Locus tag: lin2635
Name: null Funciton: Hypothetical protein
Locus tag: lin2634
Name: czcD Funciton: Cation efflux transporter
Locus tag: lin2633
Name: csbA Funciton: Hypothetical protein |
|||
czrA
|
Transcriptional repressor of multiple metal-sensing, ArsR family
|
||
Hypothetical protein
|
|||
czcD
|
Cation efflux transporter
|
||
csbA
|
Hypothetical protein
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |