Regulog SdaR - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | SdaR |
| Regulation mode: | activator |
| Biological process: | Glycerate utilization |
| Effector: | D-glycerate |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pseudomonadaceae
- By trascription factor - SdaR
- By TF family - SdaR
- By effector - D-glycerate
- By pathway - Glycerate utilization
| Genome | Genes | Operons |
|---|---|---|
| Azotobacter vinelandii AvOP | 2 | 2 |
| Pseudomonas aeruginosa PAO1 | 2 | 1 |
| Pseudomonas entomophila L48 | 3 | 2 |
| Pseudomonas fluorescens Pf-5 | 2 | 2 |
| Pseudomonas mendocina ymp | 2 | 1 |
| Pseudomonas putida KT2440 | 3 | 2 |
| Pseudomonas stutzeri A1501 | ||
| Pseudomonas syringae pv. tomato str. DC3000 | 1 | 1 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| grtT |
|
|
*
Pseudomonas entomophila L48 Site: position = -107 score = 5.77049 sequence = GGCTGTGCGAAAGCACAAAG Gene: PSEEN2880: Predicted D-glycerate transporter, MFS family |
*
Pseudomonas fluorescens Pf-5 Site: position = -2 score = 5.29196 sequence = CGTTGTTCAGTGGCACAGGG Site: position = 30 score = 5.58691 sequence = CGCTGTGCGCCGGCACAAAG Gene: PFL_3380: Predicted D-glycerate transporter, MFS family |
|
*
Pseudomonas putida KT2440 Site: position = -107 score = 5.97178 sequence = CGCTGTGCAAAAGCACAAAG Gene: PP3176: Predicted D-glycerate transporter, MFS family |
|
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -133 score = 5.25065 sequence = CGTTGTGCAATCACACAACA Gene: PSPTO1906: Predicted D-glycerate transporter, MFS family |
Predicted D-glycerate transporter, MFS family |
| CRON 2. | |||||||||
| sdaR |
*
Azotobacter vinelandii AvOP Site: position = -154 score = 5.23439 sequence = GCTTGTGCAGATGAACAATG Gene: Avin_43380: Glycerate utilization transcriptional regulator SdaR, SdaR family |
Gene: PA1050: Glycerate utilization transcriptional regulator SdaR, SdaR family |
*
Pseudomonas entomophila L48 Site: position = -75 score = 5.77049 sequence = CTTTGTGCTTTCGCACAGCC Gene: PSEEN2879: Glycerate utilization transcriptional regulator SdaR, SdaR family |
*
Pseudomonas fluorescens Pf-5 Site: position = -106 score = 5.58691 sequence = CTTTGTGCCGGCGCACAGCG Site: position = -74 score = 5.29196 sequence = CCCTGTGCCACTGAACAACG Gene: PFL_3379: Glycerate utilization transcriptional regulator SdaR, SdaR family |
Gene: Pmen_1437: Glycerate utilization transcriptional regulator SdaR, SdaR family |
*
Pseudomonas putida KT2440 Site: position = -4 score = 5.97178 sequence = CTTTGTGCTTTTGCACAGCG Gene: PP3177: Glycerate utilization transcriptional regulator SdaR, SdaR family |
|
Gene: PSPTO3281: Glycerate utilization transcriptional regulator SdaR, SdaR family |
Glycerate utilization transcriptional regulator SdaR, SdaR family |
| garK |
*
Azotobacter vinelandii AvOP Site: position = -132 score = 5.64791 sequence = TTTTGTGCGTTTGCACAGAA Gene: Avin_43390: Glycerate kinase (EC 2.7.1.31) |
Gene: PA1052: Glycerate kinase (EC 2.7.1.31) |
Gene: PSEEN2878: Glycerate kinase (EC 2.7.1.31) |
Gene: PFL_3378: Glycerate kinase (EC 2.7.1.31) |
Gene: Pmen_1439: Glycerate kinase (EC 2.7.1.31) |
Gene: PP3178: Glycerate kinase (EC 2.7.1.31) |
|
Gene: PSPTO3280: Glycerate kinase (EC 2.7.1.31) |
Glycerate kinase (EC 2.7.1.31) |
| grtP |
|
*
Pseudomonas aeruginosa PAO1 Site: position = -141 score = 5.58178 sequence = CACTGTGCAGTCGCACAAAA Gene: PA1051: D-glycerate transporter, GntP family |
|
|
*
Pseudomonas mendocina ymp Site: position = -156 score = 5.71997 sequence = GGTTGTGCATGTGCACAGCC Gene: Pmen_1438: D-glycerate transporter, GntP family |
|
|
|
D-glycerate transporter, GntP family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |