Regulon of SdaR in Pseudomonas fluorescens Pf-5

Properties
Regulator type:	Transcription factor
TF locus tag:	PFL_3379
Regulator family:	SdaR
Regulation mode:	activator
Biological process:	Glycerate utilization
Effector:	D-glycerate
Regulog:	SdaR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - SdaR
By TF family - SdaR
By effector - D-glycerate
By pathway - Glycerate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -2 Score: 5.3 Sequence: CGTTGTTCAGTGGCACAGGG Position: 30 Score: 5.6 Sequence: CGCTGTGCGCCGGCACAAAG Locus tag: PFL_3380 Name: grtT Funciton: Predicted D-glycerate transporter, MFS family
	PFL_3380	grtT	Predicted D-glycerate transporter, MFS family
Position: -106 Score: 5.6 Sequence: CTTTGTGCCGGCGCACAGCG Position: -74 Score: 5.3 Sequence: CCCTGTGCCACTGAACAACG Locus tag: PFL_3379 Name: sdaR Funciton: Glycerate utilization transcriptional regulator SdaR, SdaR family
	PFL_3379	sdaR	Glycerate utilization transcriptional regulator SdaR, SdaR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD