Regulon of SdaR in Pseudomonas syringae pv. tomato str. DC3000
| Regulator type: | Transcription factor |
| TF locus tag: | PSPTO3281 |
| Regulator family: | SdaR |
| Regulation mode: | activator |
| Biological process: | Glycerate utilization |
| Effector: | D-glycerate |
| Regulog: | SdaR - Pseudomonadaceae |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pseudomonadaceae
- By trascription factor - SdaR
- By TF family - SdaR
- By effector - D-glycerate
- By pathway - Glycerate utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -133
Score: 5.3 Sequence: CGTTGTGCAATCACACAACA
Locus tag: PSPTO1906
Name: grtT Funciton: Predicted D-glycerate transporter, MFS family |
|||
|
grtT
|
Predicted D-glycerate transporter, MFS family
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |