Regulon of SdaR in Azotobacter vinelandii AvOP

Properties
Regulator type:	Transcription factor
TF locus tag:	Avin_43380
Regulator family:	SdaR
Regulation mode:	activator
Biological process:	Glycerate utilization
Effector:	D-glycerate
Regulog:	SdaR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - SdaR
By TF family - SdaR
By effector - D-glycerate
By pathway - Glycerate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -132 Score: 5.6 Sequence: TTTTGTGCGTTTGCACAGAA Locus tag: Avin_43390 Name: garK Funciton: Glycerate kinase (EC 2.7.1.31)
	Avin_43390	garK	Glycerate kinase (EC 2.7.1.31)
Position: -154 Score: 5.2 Sequence: GCTTGTGCAGATGAACAATG Locus tag: Avin_43380 Name: sdaR Funciton: Glycerate utilization transcriptional regulator SdaR, SdaR family
	Avin_43380	sdaR	Glycerate utilization transcriptional regulator SdaR, SdaR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD