Regulog TtrR - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | LuxR |
| Regulation mode: | |
| Biological process: | Tetrathionate reduction |
| Effector: | Tetrathionate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - TtrR
- By TF family - LuxR
- By effector - Tetrathionate
- By pathway - Tetrathionate reduction
| Genome | Genes | Operons |
|---|---|---|
| Shewanella amazonensis SB2B | ||
| Shewanella baltica OS155 | 5 | 2 |
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella loihica PV-4 | ||
| Shewanella oneidensis MR-1 | ||
| Shewanella pealeana ATCC 700345 | ||
| Shewanella piezotolerans WP3 | ||
| Shewanella putrefaciens CN-32 | 5 | 2 |
| Shewanella sediminis HAW-EB3 | ||
| Shewanella sp ANA-3 | 5 | 2 |
| Shewanella sp MR-4 | 5 | 2 |
| Shewanella sp MR-7 | ||
| Shewanella sp W3-18-1 | 5 | 2 |
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| ttrB |
|
*
Shewanella baltica OS155 Site: position = -130 score = 5.96429 sequence = TGATATGTGGAAAACCACTATAGT Gene: Sbal_0591: Tetrathionate reductase subunit B |
|
|
|
|
|
|
|
*
Shewanella putrefaciens CN-32 Site: position = -130 score = 6.05628 sequence = CGATATGTGGAAAACCACTATAGT Gene: Sputcn32_0664: Tetrathionate reductase subunit B |
|
*
Shewanella sp ANA-3 Site: position = -131 score = 5.88118 sequence = CGCTATGTGGAAAACCACTATAGT Gene: Shewana3_0635: Tetrathionate reductase subunit B |
*
Shewanella sp MR-4 Site: position = -112 score = 5.96429 sequence = CGATATGTGGAAAACCACTATAGA Gene: Shewmr4_0635: Tetrathionate reductase subunit B |
|
*
Shewanella sp W3-18-1 Site: position = -131 score = 6.05628 sequence = CGATATGTGGAAAACCACTATAGT Gene: Sputw3181_3510: Tetrathionate reductase subunit B |
|
Tetrathionate reductase subunit B |
| ttrC |
|
Gene: Sbal_0590: Tetrathionate reductase subunit C |
|
|
|
|
|
|
|
Gene: Sputcn32_0663: Tetrathionate reductase subunit C |
|
Gene: Shewana3_0634: Tetrathionate reductase subunit C |
Gene: Shewmr4_0634: Tetrathionate reductase subunit C |
|
Gene: Sputw3181_3511: Tetrathionate reductase subunit C |
|
Tetrathionate reductase subunit C |
| ttrA |
|
Gene: Sbal_0589: Tetrathionate reductase subunit A |
|
|
|
|
|
|
|
Gene: Sputcn32_0662: Tetrathionate reductase subunit A |
|
Gene: Shewana3_0633: Tetrathionate reductase subunit A |
Gene: Shewmr4_0633: Tetrathionate reductase subunit A |
|
Gene: Sputw3181_3512: Tetrathionate reductase subunit A |
|
Tetrathionate reductase subunit A |
| CRON 2. | |||||||||||||||||
| ttrS |
|
*
Shewanella baltica OS155 Site: position = -299 score = 5.96429 sequence = ACTATAGTGGTTTTCCACATATCA Gene: Sbal_0592: Tetrathionate reduction sensor protein TtrS |
|
|
|
|
|
|
|
*
Shewanella putrefaciens CN-32 Site: position = -174 score = 6.05628 sequence = ACTATAGTGGTTTTCCACATATCG Gene: Sputcn32_0665: Tetrathionate reduction sensor protein TtrS |
|
*
Shewanella sp ANA-3 Site: position = -147 score = 5.88118 sequence = ACTATAGTGGTTTTCCACATAGCG Gene: Shewana3_0636: Tetrathionate reduction sensor protein TtrS |
*
Shewanella sp MR-4 Site: position = -129 score = 5.96429 sequence = TCTATAGTGGTTTTCCACATATCG Gene: Shewmr4_0636: Tetrathionate reduction sensor protein TtrS |
|
*
Shewanella sp W3-18-1 Site: position = -198 score = 6.05628 sequence = ACTATAGTGGTTTTCCACATATCG Gene: Sputw3181_3509: Tetrathionate reduction sensor protein TtrS |
|
Tetrathionate reduction sensor protein TtrS |
| ttrR |
|
Gene: Sbal_0593: Tetrathionate reduction response regulator protein TtrR, LuxR family |
|
|
|
|
|
|
|
Gene: Sputcn32_0666: Tetrathionate reduction response regulator protein TtrR, LuxR family |
|
Gene: Shewana3_0637: Tetrathionate reduction response regulator protein TtrR, LuxR family |
Gene: Shewmr4_0637: Tetrathionate reduction response regulator protein TtrR, LuxR family |
|
Gene: Sputw3181_3508: Tetrathionate reduction response regulator protein TtrR, LuxR family |
|
Tetrathionate reduction response regulator protein TtrR, LuxR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |