Regulog TtrR - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LuxR
Regulation mode:
Biological process:	Tetrathionate reduction
Effector:	Tetrathionate
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - TtrR
By TF family - LuxR
By effector - Tetrathionate
By pathway - Tetrathionate reduction

Statistics of regulated genes
Genome	Genes	Operons
Shewanella amazonensis SB2B
Shewanella baltica OS155	5	2
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella halifaxensis HAW-EB4
Shewanella loihica PV-4
Shewanella oneidensis MR-1
Shewanella pealeana ATCC 700345
Shewanella piezotolerans WP3
Shewanella putrefaciens CN-32	5	2
Shewanella sediminis HAW-EB3
Shewanella sp ANA-3	5	2
Shewanella sp MR-4	5	2
Shewanella sp MR-7
Shewanella sp W3-18-1	5	2
Shewanella woodyi ATCC 51908

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
ttrB	Shewanella amazonensis SB2B	* Shewanella baltica OS155 Site: position = -130 score = 5.96429 sequence = TGATATGTGGAAAACCACTATAGT Gene: Sbal_0591: Tetrathionate reductase subunit B	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella halifaxensis HAW-EB4	Shewanella loihica PV-4	Shewanella oneidensis MR-1	Shewanella pealeana ATCC 700345	Shewanella piezotolerans WP3	* Shewanella putrefaciens CN-32 Site: position = -130 score = 6.05628 sequence = CGATATGTGGAAAACCACTATAGT Gene: Sputcn32_0664: Tetrathionate reductase subunit B	Shewanella sediminis HAW-EB3	* Shewanella sp ANA-3 Site: position = -131 score = 5.88118 sequence = CGCTATGTGGAAAACCACTATAGT Gene: Shewana3_0635: Tetrathionate reductase subunit B	* Shewanella sp MR-4 Site: position = -112 score = 5.96429 sequence = CGATATGTGGAAAACCACTATAGA Gene: Shewmr4_0635: Tetrathionate reductase subunit B	Shewanella sp MR-7	* Shewanella sp W3-18-1 Site: position = -131 score = 6.05628 sequence = CGATATGTGGAAAACCACTATAGT Gene: Sputw3181_3510: Tetrathionate reductase subunit B	Shewanella woodyi ATCC 51908	Tetrathionate reductase subunit B
ttrC	Shewanella amazonensis SB2B	Shewanella baltica OS155 Gene: Sbal_0590: Tetrathionate reductase subunit C	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella halifaxensis HAW-EB4	Shewanella loihica PV-4	Shewanella oneidensis MR-1	Shewanella pealeana ATCC 700345	Shewanella piezotolerans WP3	Shewanella putrefaciens CN-32 Gene: Sputcn32_0663: Tetrathionate reductase subunit C	Shewanella sediminis HAW-EB3	Shewanella sp ANA-3 Gene: Shewana3_0634: Tetrathionate reductase subunit C	Shewanella sp MR-4 Gene: Shewmr4_0634: Tetrathionate reductase subunit C	Shewanella sp MR-7	Shewanella sp W3-18-1 Gene: Sputw3181_3511: Tetrathionate reductase subunit C	Shewanella woodyi ATCC 51908	Tetrathionate reductase subunit C
ttrA	Shewanella amazonensis SB2B	Shewanella baltica OS155 Gene: Sbal_0589: Tetrathionate reductase subunit A	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella halifaxensis HAW-EB4	Shewanella loihica PV-4	Shewanella oneidensis MR-1	Shewanella pealeana ATCC 700345	Shewanella piezotolerans WP3	Shewanella putrefaciens CN-32 Gene: Sputcn32_0662: Tetrathionate reductase subunit A	Shewanella sediminis HAW-EB3	Shewanella sp ANA-3 Gene: Shewana3_0633: Tetrathionate reductase subunit A	Shewanella sp MR-4 Gene: Shewmr4_0633: Tetrathionate reductase subunit A	Shewanella sp MR-7	Shewanella sp W3-18-1 Gene: Sputw3181_3512: Tetrathionate reductase subunit A	Shewanella woodyi ATCC 51908	Tetrathionate reductase subunit A

CRON 2.
ttrS	Shewanella amazonensis SB2B	* Shewanella baltica OS155 Site: position = -299 score = 5.96429 sequence = ACTATAGTGGTTTTCCACATATCA Gene: Sbal_0592: Tetrathionate reduction sensor protein TtrS	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella halifaxensis HAW-EB4	Shewanella loihica PV-4	Shewanella oneidensis MR-1	Shewanella pealeana ATCC 700345	Shewanella piezotolerans WP3	* Shewanella putrefaciens CN-32 Site: position = -174 score = 6.05628 sequence = ACTATAGTGGTTTTCCACATATCG Gene: Sputcn32_0665: Tetrathionate reduction sensor protein TtrS	Shewanella sediminis HAW-EB3	* Shewanella sp ANA-3 Site: position = -147 score = 5.88118 sequence = ACTATAGTGGTTTTCCACATAGCG Gene: Shewana3_0636: Tetrathionate reduction sensor protein TtrS	* Shewanella sp MR-4 Site: position = -129 score = 5.96429 sequence = TCTATAGTGGTTTTCCACATATCG Gene: Shewmr4_0636: Tetrathionate reduction sensor protein TtrS	Shewanella sp MR-7	* Shewanella sp W3-18-1 Site: position = -198 score = 6.05628 sequence = ACTATAGTGGTTTTCCACATATCG Gene: Sputw3181_3509: Tetrathionate reduction sensor protein TtrS	Shewanella woodyi ATCC 51908	Tetrathionate reduction sensor protein TtrS
ttrR	Shewanella amazonensis SB2B	Shewanella baltica OS155 Gene: Sbal_0593: Tetrathionate reduction response regulator protein TtrR, LuxR family	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella halifaxensis HAW-EB4	Shewanella loihica PV-4	Shewanella oneidensis MR-1	Shewanella pealeana ATCC 700345	Shewanella piezotolerans WP3	Shewanella putrefaciens CN-32 Gene: Sputcn32_0666: Tetrathionate reduction response regulator protein TtrR, LuxR family	Shewanella sediminis HAW-EB3	Shewanella sp ANA-3 Gene: Shewana3_0637: Tetrathionate reduction response regulator protein TtrR, LuxR family	Shewanella sp MR-4 Gene: Shewmr4_0637: Tetrathionate reduction response regulator protein TtrR, LuxR family	Shewanella sp MR-7	Shewanella sp W3-18-1 Gene: Sputw3181_3508: Tetrathionate reduction response regulator protein TtrR, LuxR family	Shewanella woodyi ATCC 51908	Tetrathionate reduction response regulator protein TtrR, LuxR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog TtrR - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --