Regulon of TtrR in Shewanella sp W3-18-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputw3181_3508
Regulator family:	LuxR
Regulation mode:
Biological process:	Tetrathionate reduction
Effector:	Tetrathionate
Regulog:	TtrR - Shewanellaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - TtrR
By TF family - LuxR
By effector - Tetrathionate
By pathway - Tetrathionate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -131 Score: 6.1 Sequence: CGATATGTGGAAAACCACTATAGT Locus tag: Sputw3181_3510 Name: ttrB Funciton: Tetrathionate reductase subunit B Locus tag: Sputw3181_3511 Name: ttrC Funciton: Tetrathionate reductase subunit C Locus tag: Sputw3181_3512 Name: ttrA Funciton: Tetrathionate reductase subunit A
	Sputw3181_3510	ttrB	Tetrathionate reductase subunit B
	Sputw3181_3511	ttrC	Tetrathionate reductase subunit C
	Sputw3181_3512	ttrA	Tetrathionate reductase subunit A
Position: -198 Score: 6.1 Sequence: ACTATAGTGGTTTTCCACATATCG Locus tag: Sputw3181_3509 Name: ttrS Funciton: Tetrathionate reduction sensor protein TtrS Locus tag: Sputw3181_3508 Name: ttrR Funciton: Tetrathionate reduction response regulator protein TtrR, LuxR family
	Sputw3181_3509	ttrS	Tetrathionate reduction sensor protein TtrS
	Sputw3181_3508	ttrR	Tetrathionate reduction response regulator protein TtrR, LuxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD