Regulon of TtrR in Shewanella sp MR-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr4_0637
Regulator family:	LuxR
Regulation mode:
Biological process:	Tetrathionate reduction
Effector:	Tetrathionate
Regulog:	TtrR - Shewanellaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - TtrR
By TF family - LuxR
By effector - Tetrathionate
By pathway - Tetrathionate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -112 Score: 6 Sequence: CGATATGTGGAAAACCACTATAGA Locus tag: Shewmr4_0635 Name: ttrB Funciton: Tetrathionate reductase subunit B Locus tag: Shewmr4_0634 Name: ttrC Funciton: Tetrathionate reductase subunit C Locus tag: Shewmr4_0633 Name: ttrA Funciton: Tetrathionate reductase subunit A
	Shewmr4_0635	ttrB	Tetrathionate reductase subunit B
	Shewmr4_0634	ttrC	Tetrathionate reductase subunit C
	Shewmr4_0633	ttrA	Tetrathionate reductase subunit A
Position: -129 Score: 6 Sequence: TCTATAGTGGTTTTCCACATATCG Locus tag: Shewmr4_0636 Name: ttrS Funciton: Tetrathionate reduction sensor protein TtrS Locus tag: Shewmr4_0637 Name: ttrR Funciton: Tetrathionate reduction response regulator protein TtrR, LuxR family
	Shewmr4_0636	ttrS	Tetrathionate reduction sensor protein TtrS
	Shewmr4_0637	ttrR	Tetrathionate reduction response regulator protein TtrR, LuxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD