Regulog SdaR - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | SdaR |
| Regulation mode: | activator |
| Biological process: | Glycerate utilization |
| Effector: | D-glycerate |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By trascription factor - SdaR
- By TF family - SdaR
- By effector - D-glycerate
- By pathway - Glycerate utilization
| Genome | Genes | Operons |
|---|---|---|
| Photobacterium profundum SS9 | 2 | 1 |
| Vibrio angustum S14 | ||
| Vibrio cholerae O1 biovar eltor str. N16961 | 2 | 1 |
| Vibrio fischeri ES114 | 2 | 1 |
| Vibrio harveyi ATCC BAA-1116 | 1 | 1 |
| Vibrio parahaemolyticus RIMD 2210633 | 2 | 1 |
| Vibrio salmonicida LFI1238 | 2 | 1 |
| Vibrio shilonii AK1 | ||
| Vibrio splendidus LGP32 | ||
| Vibrio vulnificus CMCP6 | 2 | 1 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| grtP |
*
Photobacterium profundum SS9 Site: position = -171 score = 6.67182 sequence = GATTGTGCAAATGCACAATT Gene: PBPRA3189: D-glycerate transporter, GntP family |
|
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -158 score = 6.39229 sequence = AATTGTGCATCTGCACAGTT Gene: VCA0904: D-glycerate transporter, GntP family |
*
Vibrio fischeri ES114 Site: position = -121 score = 6.61858 sequence = ATTTGTGCAATTGCACAATG Gene: VF_2156: D-glycerate transporter, GntP family |
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -158 score = 6.83552 sequence = TATTGTGCATTTGCACAATA Gene: VPA0116: D-glycerate transporter, GntP family |
*
Vibrio salmonicida LFI1238 Site: position = -121 score = 6.02831 sequence = CTTTGTGCATCTACACAATA Gene: VSAL_I2593: D-glycerate transporter, GntP family |
2
Vibrio shilonii AK1 Gene: VSAK1_09878: D-glycerate transporter, GntP family Gene: VSAK1_09873: D-glycerate transporter, GntP family |
|
*
Vibrio vulnificus CMCP6 Site: position = -129 score = 6.54506 sequence = AATTGTGCAGATGCACAAAA Gene: VV1_1655: D-glycerate transporter, GntP family |
D-glycerate transporter, GntP family |
| garK |
Gene: PBPRA3190: Glycerate kinase (EC 2.7.1.31) |
Gene: VAS14_20011: Glycerate kinase (EC 2.7.1.31) |
Gene: VCA0903: Glycerate kinase (EC 2.7.1.31) |
Gene: VF_2157: Glycerate kinase (EC 2.7.1.31) |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -144 score = 6.48883 sequence = AATTGTGCAAGTGCACAAAA Gene: VIBHAR_06863: Glycerate kinase (EC 2.7.1.31) |
Gene: VPA0117: Glycerate kinase (EC 2.7.1.31) |
Gene: VSAL_I2594: Glycerate kinase (EC 2.7.1.31) |
Gene: VSAK1_09883: Glycerate kinase (EC 2.7.1.31) |
|
Gene: VV1_1654: Glycerate kinase (EC 2.7.1.31) |
Glycerate kinase (EC 2.7.1.31) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |