Regulon of SdaR in Vibrio salmonicida LFI1238

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAL_I2592
Regulator family:	SdaR
Regulation mode:	activator
Biological process:	Glycerate utilization
Effector:	D-glycerate
Regulog:	SdaR - Vibrionales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - SdaR
By TF family - SdaR
By effector - D-glycerate
By pathway - Glycerate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 6 Sequence: CTTTGTGCATCTACACAATA Locus tag: VSAL_I2593 Name: grtP Funciton: D-glycerate transporter, GntP family Locus tag: VSAL_I2594 Name: garK Funciton: Glycerate kinase (EC 2.7.1.31)
	VSAL_I2593	grtP	D-glycerate transporter, GntP family
	VSAL_I2594	garK	Glycerate kinase (EC 2.7.1.31)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD