Regulon of SdaR in Vibrio cholerae O1 biovar eltor str. N16961

Properties
Regulator type:	Transcription factor
TF locus tag:	VCA0905
Regulator family:	SdaR
Regulation mode:	activator
Biological process:	Glycerate utilization
Effector:	D-glycerate
Regulog:	SdaR - Vibrionales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - SdaR
By TF family - SdaR
By effector - D-glycerate
By pathway - Glycerate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -158 Score: 6.4 Sequence: AATTGTGCATCTGCACAGTT Locus tag: VCA0904 Name: grtP Funciton: D-glycerate transporter, GntP family Locus tag: VCA0903 Name: garK Funciton: Glycerate kinase (EC 2.7.1.31)
	VCA0904	grtP	D-glycerate transporter, GntP family
	VCA0903	garK	Glycerate kinase (EC 2.7.1.31)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD