Regulog TreR - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Trehalose utilization |
| Effector: | Trehalose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - LacI
- By effector - Trehalose
- By pathway - Trehalose utilization
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | ||
| Shewanella putrefaciens CN-32 | ||
| Shewanella sp W3-18-1 | ||
| Shewanella sp ANA-3 | ||
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | 4 | 3 |
| Shewanella amazonensis SB2B | ||
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | ||
| Shewanella woodyi ATCC 51908 | 5 | 4 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| treT |
|
|
|
|
|
|
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -72 score = 6.54952 sequence = AAATGCAAACGATTGCATTA Gene: Sfri_3505: Predicted trehalose permease, MFS family, FucP subfamily |
|
|
|
|
|
|
*
Shewanella woodyi ATCC 51908 Site: position = -175 score = 6.37839 sequence = TTTTGCAAACGATTGCAAAA Gene: Swoo_1438: Predicted trehalose permease, MFS family, FucP subfamily |
Predicted trehalose permease, MFS family, FucP subfamily |
| treF |
|
|
|
|
|
|
|
|
Gene: Sfri_3506: Trehalase (EC 3.2.1.28) |
|
|
|
|
|
|
|
Trehalase (EC 3.2.1.28) |
| CRON 2. | |||||||||||||||||
| treR |
|
|
|
|
|
|
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -103 score = 6.46552 sequence = TTATGCAAACGTTTGCATTT Site: position = -126 score = 6.38775 sequence = CAATGCAAACGTTTGCAATA Gene: Sfri_3504: Transcriptional regulator of trehalose utilization, LacI family |
|
|
|
|
|
|
*
Shewanella woodyi ATCC 51908 Site: position = -106 score = 5.99443 sequence = GCTTGCAAACGATTGCAATT Site: position = -83 score = 6.44024 sequence = TTTTGCAATCGTTTGCATTT Gene: Swoo_1435: Transcriptional regulator of trehalose utilization, LacI family |
Transcriptional regulator of trehalose utilization, LacI family |
| CRON 3. | |||||||||||||||||
| treP |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella woodyi ATCC 51908 Site: position = -73 score = 6.37839 sequence = TTTTGCAATCGTTTGCAAAA Gene: Swoo_1437: Trehalose phosphorylase (EC 2.4.1.64) |
Trehalose phosphorylase (EC 2.4.1.64) |
| pgm2 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: Swoo_1436: beta-phosphoglucomutase |
beta-phosphoglucomutase |
| CRON 4. | |||||||||||||||||
| omp(Tre) |
|
|
|
|
|
|
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -110 score = 6.38775 sequence = TATTGCAAACGTTTGCATTG Site: position = -133 score = 6.46552 sequence = AAATGCAAACGTTTGCATAA Gene: Sfri_3503: Trehalose-regulated TonB-dependent outer membrane receptor |
|
|
|
|
|
|
*
Shewanella woodyi ATCC 51908 Site: position = -160 score = 6.44024 sequence = AAATGCAAACGATTGCAAAA Site: position = -137 score = 5.99443 sequence = AATTGCAATCGTTTGCAAGC Gene: Swoo_1434: Trehalose-regulated TonB-dependent outer membrane receptor |
Trehalose-regulated TonB-dependent outer membrane receptor |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |