Regulog TreR - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - LacI
By effector - Trehalose
By pathway - Trehalose utilization

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3
Shewanella sp MR-4
Shewanella sp MR-7
Shewanella baltica OS155
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400	4	3
Shewanella amazonensis SB2B
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908	5	4

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
treT	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -72 score = 6.54952 sequence = AAATGCAAACGATTGCATTA Gene: Sfri_3505: Predicted trehalose permease, MFS family, FucP subfamily	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	* Shewanella woodyi ATCC 51908 Site: position = -175 score = 6.37839 sequence = TTTTGCAAACGATTGCAAAA Gene: Swoo_1438: Predicted trehalose permease, MFS family, FucP subfamily	Predicted trehalose permease, MFS family, FucP subfamily
treF	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3506: Trehalase (EC 3.2.1.28)	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Trehalase (EC 3.2.1.28)

CRON 2.
treR	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -103 score = 6.46552 sequence = TTATGCAAACGTTTGCATTT Site: position = -126 score = 6.38775 sequence = CAATGCAAACGTTTGCAATA Gene: Sfri_3504: Transcriptional regulator of trehalose utilization, LacI family	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	* Shewanella woodyi ATCC 51908 Site: position = -106 score = 5.99443 sequence = GCTTGCAAACGATTGCAATT Site: position = -83 score = 6.44024 sequence = TTTTGCAATCGTTTGCATTT Gene: Swoo_1435: Transcriptional regulator of trehalose utilization, LacI family	Transcriptional regulator of trehalose utilization, LacI family

CRON 3.
treP	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	* Shewanella woodyi ATCC 51908 Site: position = -73 score = 6.37839 sequence = TTTTGCAATCGTTTGCAAAA Gene: Swoo_1437: Trehalose phosphorylase (EC 2.4.1.64)	Trehalose phosphorylase (EC 2.4.1.64)
pgm2	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_1436: beta-phosphoglucomutase	beta-phosphoglucomutase

CRON 4.
omp(Tre)	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -110 score = 6.38775 sequence = TATTGCAAACGTTTGCATTG Site: position = -133 score = 6.46552 sequence = AAATGCAAACGTTTGCATAA Gene: Sfri_3503: Trehalose-regulated TonB-dependent outer membrane receptor	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	* Shewanella woodyi ATCC 51908 Site: position = -160 score = 6.44024 sequence = AAATGCAAACGATTGCAAAA Site: position = -137 score = 5.99443 sequence = AATTGCAATCGTTTGCAAGC Gene: Swoo_1434: Trehalose-regulated TonB-dependent outer membrane receptor	Trehalose-regulated TonB-dependent outer membrane receptor

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog TreR - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --