Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing treP gene

Properties
Regulog: TreR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Trehalose utilization
Effector: Trehalose
Phylum: Proteobacteria/gamma
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella woodyi ATCC 51908
Position: -73
Score: 6.37839
Sequence: TTTTGCAATCGTTTGCAAAA
Locus tag: Swoo_1437
Name: treP
Funciton: Trehalose phosphorylase (EC 2.4.1.64)
Locus tag: Swoo_1436
Name: pgm2
Funciton: beta-phosphoglucomutase
treP-pgm2 -73 6.4 TTTTGCAATCGTTTGCAAAA Swoo_1437
© 2009-2020 RegPrecise