Regulon of TreR in Shewanella woodyi ATCC 51908

Properties
Regulator type:	Transcription factor
TF locus tag:	Swoo_1435
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Regulog:	TreR - Shewanellaceae
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - LacI
By effector - Trehalose
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -73 Score: 6.4 Sequence: TTTTGCAATCGTTTGCAAAA Locus tag: Swoo_1437 Name: treP Funciton: Trehalose phosphorylase (EC 2.4.1.64) Locus tag: Swoo_1436 Name: pgm2 Funciton: beta-phosphoglucomutase
	Swoo_1437	treP	Trehalose phosphorylase (EC 2.4.1.64)
	Swoo_1436	pgm2	beta-phosphoglucomutase
Position: -106 Score: 6 Sequence: GCTTGCAAACGATTGCAATT Position: -83 Score: 6.4 Sequence: TTTTGCAATCGTTTGCATTT Locus tag: Swoo_1435 Name: treR Funciton: Transcriptional regulator of trehalose utilization, LacI family
	Swoo_1435	treR	Transcriptional regulator of trehalose utilization, LacI family
Position: -160 Score: 6.4 Sequence: AAATGCAAACGATTGCAAAA Position: -137 Score: 6 Sequence: AATTGCAATCGTTTGCAAGC Locus tag: Swoo_1434 Name: omp(Tre) Funciton: Trehalose-regulated TonB-dependent outer membrane receptor
	Swoo_1434	omp(Tre)	Trehalose-regulated TonB-dependent outer membrane receptor
Position: -175 Score: 6.4 Sequence: TTTTGCAAACGATTGCAAAA Locus tag: Swoo_1438 Name: treT Funciton: Predicted trehalose permease, MFS family, FucP subfamily
	Swoo_1438	treT	Predicted trehalose permease, MFS family, FucP subfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD