Regulog AmtR - Micrococcineae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Nitrogen metabolism |
| Effector: | GlnK-AMP, signal transduction protein |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - AmtR
- By taxonomy - Micrococcineae
- By TF family - TetR
- By effector - GlnK-AMP, signal transduction protein
- By pathway - Nitrogen metabolism
| Genome | Genes | Operons |
|---|---|---|
| Arthrobacter aurescens TC1 | 6 | 2 |
| Arthrobacter chlorophenolicus A6 | ||
| Arthrobacter sp. FB24 | 6 | 2 |
| Beutenbergia cavernae DSM 12333 | ||
| Brachybacterium faecium DSM 4810 | ||
| Brevibacterium linens BL2 | ||
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | 5 | 1 |
| Janibacter sp. HTCC2649 | ||
| Jonesia denitrificans DSM 20603 | ||
| Kocuria rhizophila DC2201 | ||
| Kytococcus sedentarius DSM 20547 | ||
| Leifsonia xyli subsp. xyli str. CTCB07 | ||
| Renibacterium salmoninarum ATCC 33209 | ||
| Tropheryma whipplei str. Twist |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| uctT |
*
Arthrobacter aurescens TC1 Site: position = -90 score = 4.92434 sequence = GAAAACTATCAAGTGACCGATATT Gene: AAur_0190: Urea carboxylase-related transporter, Amino acid permease family |
|
*
Arthrobacter sp. FB24 Site: position = -93 score = 4.83495 sequence = GAAAACTATCAAGTGACCGGTATT Gene: Arth_3666: Urea carboxylase-related transporter, Amino acid permease family |
|
|
|
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -87 score = 5.246 sequence = AATACCTATCGCTCGATAGATACT Gene: CMM_0123: Urea carboxylase-related transporter, Amino acid permease family |
|
|
|
|
|
|
|
Urea carboxylase-related transporter, Amino acid permease family |
| amt1 |
Gene: AAur_0189: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
Gene: Arth_3667: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
|
|
Gene: CMM_0122: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
|
|
|
|
|
|
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
| amt2 |
Gene: AAur_0188: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
Gene: Arth_3668: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
|
|
Gene: CMM_0121: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
|
|
|
|
|
|
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
| ucaA |
Gene: AAur_0187: Urea carboxylase (EC 6.3.4.6) |
|
Gene: Arth_3669: Urea carboxylase (EC 6.3.4.6) |
|
|
|
Gene: CMM_0120: Urea carboxylase (EC 6.3.4.6) |
|
|
|
|
|
|
|
Urea carboxylase (EC 6.3.4.6) |
| amtR |
*
Arthrobacter aurescens TC1 Site: position = -162 score = 4.92434 sequence = AATATCGGTCACTTGATAGTTTTC Gene: AAur_0192: Transcriptional regulator of urea utilization, TetR family |
|
*
Arthrobacter sp. FB24 Site: position = -163 score = 4.83495 sequence = AATACCGGTCACTTGATAGTTTTC Gene: Arth_3665: Transcriptional regulator of urea utilization, TetR family |
|
|
|
Gene: CMM_0119: Transcriptional regulator of urea utilization, TetR family |
|
|
|
|
|
|
|
Transcriptional regulator of urea utilization, TetR family |
| ucaB |
Gene: AAur_0186: Allophanate hydrolase (EC 3.5.1.54) |
|
Gene: Arth_3670: Allophanate hydrolase (EC 3.5.1.54) |
|
|
|
Gene: CMM_2824: Allophanate hydrolase (EC 3.5.1.54) |
|
|
|
|
|
|
|
Allophanate hydrolase (EC 3.5.1.54) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |