Orthologous regulated operons containing ucaB gene

Properties
Regulog:	AmtR - Micrococcineae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Phylum:	Actinobacteria

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Arthrobacter aurescens TC1
Position: -90 Score: 4.92434 Sequence: GAAAACTATCAAGTGACCGATATT Locus tag: AAur_0190 Name: uctT Funciton: Urea carboxylase-related transporter, Amino acid permease family Locus tag: AAur_0189 Name: amt1 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: AAur_0188 Name: amt2 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: AAur_0187 Name: ucaA Funciton: Urea carboxylase (EC 6.3.4.6) Locus tag: AAur_0186 Name: ucaB Funciton: Allophanate hydrolase (EC 3.5.1.54)
uctT-amt1-amt2-ucaA-ucaB	-90	4.9	GAAAACTATCAAGTGACCGATATT	AAur_0190
Arthrobacter sp. FB24
Position: -93 Score: 4.83495 Sequence: GAAAACTATCAAGTGACCGGTATT Locus tag: Arth_3666 Name: uctT Funciton: Urea carboxylase-related transporter, Amino acid permease family Locus tag: Arth_3667 Name: amt1 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: Arth_3668 Name: amt2 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: Arth_3669 Name: ucaA Funciton: Urea carboxylase (EC 6.3.4.6) Locus tag: Arth_3670 Name: ucaB Funciton: Allophanate hydrolase (EC 3.5.1.54)
uctT-amt1-amt2-ucaA-ucaB	-93	4.8	GAAAACTATCAAGTGACCGGTATT	Arth_3666

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --