Regulon of AmtR in Clavibacter michiganensis subsp. michiganensis NCPPB 382

Properties
Regulator type:	Transcription factor
TF locus tag:	CMM_0119
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Regulog:	AmtR - Micrococcineae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By trascription factor - AmtR
By taxonomy - Micrococcineae
By TF family - TetR
By effector - GlnK-AMP, signal transduction protein
By pathway - Nitrogen metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 5.2 Sequence: AATACCTATCGCTCGATAGATACT Locus tag: CMM_0123 Name: uctT Funciton: Urea carboxylase-related transporter, Amino acid permease family Locus tag: CMM_0122 Name: amt1 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: CMM_0121 Name: amt2 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: CMM_0120 Name: ucaA Funciton: Urea carboxylase (EC 6.3.4.6) Locus tag: CMM_0119 Name: amtR Funciton: Transcriptional regulator of urea utilization, TetR family
	CMM_0123	uctT	Urea carboxylase-related transporter, Amino acid permease family
	CMM_0122	amt1	Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
	CMM_0121	amt2	Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
	CMM_0120	ucaA	Urea carboxylase (EC 6.3.4.6)
	CMM_0119	amtR	Transcriptional regulator of urea utilization, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD