Regulog SO4326 - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Multidrug resistance

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1	3	1
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3	3	1
Shewanella sp MR-4
Shewanella sp MR-7
Shewanella baltica OS155
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B	3	1
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345	3	1
Shewanella halifaxensis HAW-EB4	3	1
Shewanella piezotolerans WP3	3	1
Shewanella sediminis HAW-EB3	3	1
Shewanella woodyi ATCC 51908	3	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
vexR	* Shewanella oneidensis MR-1 Site: position = 0 score = 7.60293 sequence = ATGAATGAACGTTCATTCAT Gene: SO_4326: putative bile resistance transcriptional regulator VexR, TetR family	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	* Shewanella sp ANA-3 Site: position = -42 score = 7.60293 sequence = ATGAATGAACGTTCATTCAT Gene: Shewana3_0373: putative bile resistance transcriptional regulator VexR, TetR family	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	* Shewanella amazonensis SB2B Site: position = -34 score = 7.41415 sequence = ATGAATGAACGTTCATTCAC Gene: Sama_3267: putative bile resistance transcriptional regulator VexR, TetR family	Shewanella loihica PV-4	* Shewanella pealeana ATCC 700345 Site: position = 0 score = 7.60293 sequence = ATGAATGAACGTTCATTCAT Gene: Spea_0359: putative bile resistance transcriptional regulator VexR, TetR family	* Shewanella halifaxensis HAW-EB4 Site: position = 15 score = 7.60293 sequence = ATGAATGAACGTTCATTCAT Gene: Shal_3931: putative bile resistance transcriptional regulator VexR, TetR family	* Shewanella piezotolerans WP3 Site: position = -107 score = 7.60293 sequence = ATGAATGAACGTTCATTCAT Gene: swp_0380: transcriptional regulator, TetR family	* Shewanella sediminis HAW-EB3 Site: position = 0 score = 7.13695 sequence = GTGAATGAACGTTCATTCAG Gene: Ssed_4148: putative bile resistance transcriptional regulator VexR, TetR family	* Shewanella woodyi ATCC 51908 Site: position = -44 score = 6.88567 sequence = ATGAATGAACATTCATTCAC Gene: Swoo_0467: putative bile resistance transcriptional regulator VexR, TetR family	putative bile resistance transcriptional regulator VexR, TetR family
vexB	Shewanella oneidensis MR-1 Gene: SO_4327: Probable Co/Zn/Cd efflux system membrane fusion protein	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3 Gene: Shewana3_0372: Probable Co/Zn/Cd efflux system membrane fusion protein	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B Gene: Sama_3268: Probable Co/Zn/Cd efflux system membrane fusion protein	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_0358: Probable Co/Zn/Cd efflux system membrane fusion protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_3932: Probable Co/Zn/Cd efflux system membrane fusion protein	Shewanella piezotolerans WP3 Gene: swp_0379: Probable Co/Zn/Cd efflux system membrane fusion protein	Shewanella sediminis HAW-EB3 Gene: Ssed_4149: Probable Co/Zn/Cd efflux system membrane fusion protein	Shewanella woodyi ATCC 51908 Gene: Swoo_0466: Probable Co/Zn/Cd efflux system membrane fusion protein	Probable Co/Zn/Cd efflux system membrane fusion protein
vexA	Shewanella oneidensis MR-1 Gene: SO_4327.1: Cation/multidrug efflux pump	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3 Gene: Shewana3_0371: Cation/multidrug efflux pump	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B Gene: Sama_3269: Cation/multidrug efflux pump	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_0357: Cation/multidrug efflux pump	Shewanella halifaxensis HAW-EB4 Gene: Shal_3933: Cation/multidrug efflux pump	Shewanella piezotolerans WP3 Gene: swp_0378: Cation/multidrug efflux pump	Shewanella sediminis HAW-EB3 Gene: Ssed_4150: Cation/multidrug efflux pump	Shewanella woodyi ATCC 51908 Gene: Swoo_0465: Cation/multidrug efflux pump	Cation/multidrug efflux pump

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SO4326 - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --