Regulog SO4326 - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - TetR
- By pathway - Multidrug resistance
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 3 | 1 |
| Shewanella putrefaciens CN-32 | ||
| Shewanella sp W3-18-1 | ||
| Shewanella sp ANA-3 | 3 | 1 |
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella amazonensis SB2B | 3 | 1 |
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | 3 | 1 |
| Shewanella halifaxensis HAW-EB4 | 3 | 1 |
| Shewanella piezotolerans WP3 | 3 | 1 |
| Shewanella sediminis HAW-EB3 | 3 | 1 |
| Shewanella woodyi ATCC 51908 | 3 | 1 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| vexR |
*
Shewanella oneidensis MR-1 Site: position = 0 score = 7.60293 sequence = ATGAATGAACGTTCATTCAT Gene: SO_4326: putative bile resistance transcriptional regulator VexR, TetR family |
|
|
*
Shewanella sp ANA-3 Site: position = -42 score = 7.60293 sequence = ATGAATGAACGTTCATTCAT Gene: Shewana3_0373: putative bile resistance transcriptional regulator VexR, TetR family |
|
|
|
|
|
*
Shewanella amazonensis SB2B Site: position = -34 score = 7.41415 sequence = ATGAATGAACGTTCATTCAC Gene: Sama_3267: putative bile resistance transcriptional regulator VexR, TetR family |
|
*
Shewanella pealeana ATCC 700345 Site: position = 0 score = 7.60293 sequence = ATGAATGAACGTTCATTCAT Gene: Spea_0359: putative bile resistance transcriptional regulator VexR, TetR family |
*
Shewanella halifaxensis HAW-EB4 Site: position = 15 score = 7.60293 sequence = ATGAATGAACGTTCATTCAT Gene: Shal_3931: putative bile resistance transcriptional regulator VexR, TetR family |
*
Shewanella piezotolerans WP3 Site: position = -107 score = 7.60293 sequence = ATGAATGAACGTTCATTCAT Gene: swp_0380: transcriptional regulator, TetR family |
*
Shewanella sediminis HAW-EB3 Site: position = 0 score = 7.13695 sequence = GTGAATGAACGTTCATTCAG Gene: Ssed_4148: putative bile resistance transcriptional regulator VexR, TetR family |
*
Shewanella woodyi ATCC 51908 Site: position = -44 score = 6.88567 sequence = ATGAATGAACATTCATTCAC Gene: Swoo_0467: putative bile resistance transcriptional regulator VexR, TetR family |
putative bile resistance transcriptional regulator VexR, TetR family |
| vexB |
Gene: SO_4327: Probable Co/Zn/Cd efflux system membrane fusion protein |
|
|
Gene: Shewana3_0372: Probable Co/Zn/Cd efflux system membrane fusion protein |
|
|
|
|
|
Gene: Sama_3268: Probable Co/Zn/Cd efflux system membrane fusion protein |
|
Gene: Spea_0358: Probable Co/Zn/Cd efflux system membrane fusion protein |
Gene: Shal_3932: Probable Co/Zn/Cd efflux system membrane fusion protein |
Gene: swp_0379: Probable Co/Zn/Cd efflux system membrane fusion protein |
Gene: Ssed_4149: Probable Co/Zn/Cd efflux system membrane fusion protein |
Gene: Swoo_0466: Probable Co/Zn/Cd efflux system membrane fusion protein |
Probable Co/Zn/Cd efflux system membrane fusion protein |
| vexA |
Gene: SO_4327.1: Cation/multidrug efflux pump |
|
|
Gene: Shewana3_0371: Cation/multidrug efflux pump |
|
|
|
|
|
Gene: Sama_3269: Cation/multidrug efflux pump |
|
Gene: Spea_0357: Cation/multidrug efflux pump |
Gene: Shal_3933: Cation/multidrug efflux pump |
Gene: swp_0378: Cation/multidrug efflux pump |
Gene: Ssed_4150: Cation/multidrug efflux pump |
Gene: Swoo_0465: Cation/multidrug efflux pump |
Cation/multidrug efflux pump |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |