Regulon of SO4326 in Shewanella woodyi ATCC 51908

Properties
Regulator type:	Transcription factor
TF locus tag:	Swoo_0467
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Regulog:	SO4326 - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 6.9 Sequence: ATGAATGAACATTCATTCAC Locus tag: Swoo_0467 Name: vexR Funciton: putative bile resistance transcriptional regulator VexR, TetR family Locus tag: Swoo_0466 Name: vexB Funciton: Probable Co/Zn/Cd efflux system membrane fusion protein Locus tag: Swoo_0465 Name: vexA Funciton: Cation/multidrug efflux pump
	Swoo_0467	vexR	putative bile resistance transcriptional regulator VexR, TetR family
	Swoo_0466	vexB	Probable Co/Zn/Cd efflux system membrane fusion protein
	Swoo_0465	vexA	Cation/multidrug efflux pump

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD