Regulon of SO4326 in Shewanella piezotolerans WP3

Properties
Regulator type:	Transcription factor
TF locus tag:	swp_0380
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Regulog:	SO4326 - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -107 Score: 7.6 Sequence: ATGAATGAACGTTCATTCAT Locus tag: swp_0380 Name: null Funciton: transcriptional regulator, TetR family Locus tag: swp_0379 Name: vexB Funciton: Probable Co/Zn/Cd efflux system membrane fusion protein Locus tag: swp_0378 Name: vexA Funciton: Cation/multidrug efflux pump
	swp_0380		transcriptional regulator, TetR family
	swp_0379	vexB	Probable Co/Zn/Cd efflux system membrane fusion protein
	swp_0378	vexA	Cation/multidrug efflux pump

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD