Regulon of SO4326 in Shewanella sediminis HAW-EB3
| Regulator type: | Transcription factor |
| TF locus tag: | Ssed_4148 |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Multidrug resistance |
| Effector: | |
| Regulog: | SO4326 - Shewanellaceae |
| Statistics of regulated genes: | |
| - Genes | 3 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - TetR
- By pathway - Multidrug resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: 0
Score: 7.1 Sequence: GTGAATGAACGTTCATTCAG
Locus tag: Ssed_4148
Name: vexR Funciton: putative bile resistance transcriptional regulator VexR, TetR family
Locus tag: Ssed_4149
Name: vexB Funciton: Probable Co/Zn/Cd efflux system membrane fusion protein
Locus tag: Ssed_4150
Name: vexA Funciton: Cation/multidrug efflux pump |
|||
|
vexR
|
putative bile resistance transcriptional regulator VexR, TetR family
|
||
|
vexB
|
Probable Co/Zn/Cd efflux system membrane fusion protein
|
||
|
vexA
|
Cation/multidrug efflux pump
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |