Regulog SO1703 - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Multidrug resistance

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1	2	1
Shewanella putrefaciens CN-32	4	1
Shewanella sp W3-18-1	4	1
Shewanella sp ANA-3	4	1
Shewanella sp MR-4	4	1
Shewanella sp MR-7	4	1
Shewanella baltica OS155	4	1
Shewanella denitrificans OS217	3	1
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B	4	1
Shewanella loihica PV-4	3	1
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3	3	1
Shewanella woodyi ATCC 51908

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
SO1703	* Shewanella oneidensis MR-1 Site: position = -35 score = 6.47532 sequence = TATTCATCAGTAGATGAATT Gene: SO_1703: Transcriptional regulator, TetR family	* Shewanella putrefaciens CN-32 Site: position = -35 score = 6.47532 sequence = TATTCATCAGTAGATGAATT Gene: Sputcn32_1419: Transcriptional regulator, TetR family	* Shewanella sp W3-18-1 Site: position = -35 score = 6.47532 sequence = TATTCATCAGTAGATGAATT Gene: Sputw3181_2681: Transcriptional regulator, TetR family	* Shewanella sp ANA-3 Site: position = -35 score = 6.47532 sequence = TATTCATCAGTAGATGAATT Gene: Shewana3_2751: Transcriptional regulator, TetR family	* Shewanella sp MR-4 Site: position = -35 score = 6.56804 sequence = TATTCATCAATAGATGAATT Gene: Shewmr4_2576: Transcriptional regulator, TetR family	* Shewanella sp MR-7 Site: position = -35 score = 6.56804 sequence = TATTCATCAATAGATGAATT Gene: Shewmr7_2643: Transcriptional regulator, TetR family	* Shewanella baltica OS155 Site: position = -35 score = 6.56804 sequence = TATTCATCAATAGATGAATT Gene: Sbal_1521: Transcriptional regulator, TetR family	* Shewanella denitrificans OS217 Site: position = -64 score = 5.74714 sequence = TATTCATCAGATGGGGAATT Gene: Sden_2204: Transcriptional regulator, TetR family	Shewanella frigidimarina NCIMB 400	* Shewanella amazonensis SB2B Site: position = -33 score = 5.75835 sequence = TGTTCATCAAGAGAGGAATT Gene: Sama_3590: Transcriptional regulator, TetR family	* Shewanella loihica PV-4 Site: position = -23 score = 6.29599 sequence = AATTCCTCTACTGAGGAATT Gene: Shew_3567: Transcriptional regulator, TetR family	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	* Shewanella sediminis HAW-EB3 Site: position = -24 score = 5.73009 sequence = AATTCTTTAACTGAGGAATA Gene: Ssed_2917: Transcriptional regulator, TetR family	Shewanella woodyi ATCC 51908	Transcriptional regulator, TetR family
SO1705	Shewanella oneidensis MR-1 Gene: SO_1705: hypothetical HlyD family secretion protein	Shewanella putrefaciens CN-32 Gene: Sputcn32_1420: hypothetical HlyD family secretion protein	Shewanella sp W3-18-1 Gene: Sputw3181_2680: hypothetical HlyD family secretion protein	Shewanella sp ANA-3 Gene: Shewana3_2750: hypothetical HlyD family secretion protein	Shewanella sp MR-4 Gene: Shewmr4_2575: hypothetical HlyD family secretion protein	Shewanella sp MR-7 Gene: Shewmr7_2642: hypothetical HlyD family secretion protein	Shewanella baltica OS155 Gene: Sbal_1522: hypothetical HlyD family secretion protein	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3537: hypothetical HlyD family secretion protein	Shewanella amazonensis SB2B Gene: Sama_3589: hypothetical HlyD family secretion protein	Shewanella loihica PV-4 Gene: Shew_0427: hypothetical HlyD family secretion protein	Shewanella pealeana ATCC 700345 Gene: Spea_4203: hypothetical HlyD family secretion protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_0049: hypothetical HlyD family secretion protein	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_0587: hypothetical HlyD family secretion protein	Shewanella woodyi ATCC 51908 Gene: Swoo_4361: hypothetical HlyD family secretion protein	hypothetical HlyD family secretion protein
SO1706	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32 Gene: Sputcn32_1421: ABC-type multidrug transport system, ATPase component	Shewanella sp W3-18-1 Gene: Sputw3181_2679: ABC-type multidrug transport system, ATPase component	Shewanella sp ANA-3 Gene: Shewana3_2749: ABC-type multidrug transport system, ATPase component	Shewanella sp MR-4 Gene: Shewmr4_2574: ABC-type multidrug transport system, ATPase component	Shewanella sp MR-7 Gene: Shewmr7_2641: ABC-type multidrug transport system, ATPase component	Shewanella baltica OS155 Gene: Sbal_1523: ABC-type multidrug transport system, ATPase component	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3538: ABC-type multidrug transport system, ATPase component	Shewanella amazonensis SB2B Gene: Sama_3588: ABC-type multidrug transport system, ATPase component	Shewanella loihica PV-4 Gene: Shew_0426: ABC-type multidrug transport system, ATPase component	Shewanella pealeana ATCC 700345 Gene: Spea_4202: ABC-type multidrug transport system, ATPase component	Shewanella halifaxensis HAW-EB4 Gene: Shal_0050: ABC-type multidrug transport system, ATPase component	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_0586: ABC-type multidrug transport system, ATPase component	Shewanella woodyi ATCC 51908 Gene: Swoo_4362: ABC-type multidrug transport system, ATPase component	ABC-type multidrug transport system, ATPase component
SO1707	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32 Gene: Sputcn32_1422: ABC transporter, permease protein, putative	Shewanella sp W3-18-1 Gene: Sputw3181_2678: ABC transporter, permease protein, putative	Shewanella sp ANA-3 Gene: Shewana3_2748: ABC transporter, permease protein, putative	Shewanella sp MR-4 Gene: Shewmr4_2573: ABC transporter, permease protein, putative	Shewanella sp MR-7 Gene: Shewmr7_2640: ABC transporter, permease protein, putative	Shewanella baltica OS155 Gene: Sbal_1524: ABC transporter, permease protein, putative	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3539: ABC transporter, permease protein, putative	Shewanella amazonensis SB2B Gene: Sama_3587: ABC transporter, permease protein, putative	Shewanella loihica PV-4 Gene: Shew_0425: ABC transporter, permease protein, putative	Shewanella pealeana ATCC 700345 Gene: Spea_4201: ABC transporter, permease protein, putative	Shewanella halifaxensis HAW-EB4 Gene: Shal_0051: ABC transporter, permease protein, putative	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_0585: ABC transporter, permease protein, putative	Shewanella woodyi ATCC 51908 Gene: Swoo_4363: ABC transporter, permease protein, putative	ABC transporter, permease protein, putative
Shew_3566	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217 Gene: Sden_2205: efflux transporter, RND family, MFP subunit	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4 Gene: Shew_3566: efflux transporter, RND family, MFP subunit	Shewanella pealeana ATCC 700345 Gene: Spea_1562: efflux transporter, RND family, MFP subunit	Shewanella halifaxensis HAW-EB4 Gene: Shal_1628: efflux transporter, RND family, MFP subunit	Shewanella piezotolerans WP3 Gene: swp_1783: efflux transporter, RND family, MFP subunit	Shewanella sediminis HAW-EB3 Gene: Ssed_2916: efflux transporter, RND family, MFP subunit	Shewanella woodyi ATCC 51908	efflux transporter, RND family, MFP subunit
Sden_2206	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217 Gene: Sden_2206: Acriflavin resistance transporter, membrane protein	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4 Gene: Shew_3565: Acriflavin resistance transporter, membrane protein	Shewanella pealeana ATCC 700345 Gene: Spea_1563: Acriflavin resistance transporter, membrane protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_1629: Acriflavin resistance transporter, membrane protein	Shewanella piezotolerans WP3 Gene: swp_1784: Acriflavin resistance transporter, membrane protein	Shewanella sediminis HAW-EB3 Gene: Ssed_2915: Acriflavin resistance transporter, membrane protein	Shewanella woodyi ATCC 51908	Acriflavin resistance transporter, membrane protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SO1703 - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --