Regulon of SO1703 in Shewanella amazonensis SB2B

Properties
Regulator type:	Transcription factor
TF locus tag:	Sama_3590
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Regulog:	SO1703 - Shewanellaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 5.8 Sequence: TGTTCATCAAGAGAGGAATT Locus tag: Sama_3590 Name: SO1703 Funciton: Transcriptional regulator, TetR family Locus tag: Sama_3589 Name: SO1705 Funciton: hypothetical HlyD family secretion protein Locus tag: Sama_3588 Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Sama_3587 Name: SO1707 Funciton: ABC transporter, permease protein, putative
	Sama_3590	SO1703	Transcriptional regulator, TetR family
	Sama_3589	SO1705	hypothetical HlyD family secretion protein
	Sama_3588	SO1706	ABC-type multidrug transport system, ATPase component
	Sama_3587	SO1707	ABC transporter, permease protein, putative

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD