Regulon of SO1703 in Shewanella loihica PV-4

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Regulog:	SO1703 - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -23 Score: 6.3 Sequence: AATTCCTCTACTGAGGAATT Locus tag: Shew_3567 Name: SO1703 Funciton: Transcriptional regulator, TetR family Locus tag: Shew_3566 Name: Shew_3566 Funciton: efflux transporter, RND family, MFP subunit Locus tag: Shew_3565 Name: Sden_2206 Funciton: Acriflavin resistance transporter, membrane protein
	Shew_3567	SO1703	Transcriptional regulator, TetR family
	Shew_3566	Shew_3566	efflux transporter, RND family, MFP subunit
	Shew_3565	Sden_2206	Acriflavin resistance transporter, membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD