Regulon of SO1703 in Shewanella putrefaciens CN-32

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputcn32_1419
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Regulog:	SO1703 - Shewanellaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 6.5 Sequence: TATTCATCAGTAGATGAATT Locus tag: Sputcn32_1419 Name: SO1703 Funciton: Transcriptional regulator, TetR family Locus tag: Sputcn32_1420 Name: SO1705 Funciton: hypothetical HlyD family secretion protein Locus tag: Sputcn32_1421 Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Sputcn32_1422 Name: SO1707 Funciton: ABC transporter, permease protein, putative
	Sputcn32_1419	SO1703	Transcriptional regulator, TetR family
	Sputcn32_1420	SO1705	hypothetical HlyD family secretion protein
	Sputcn32_1421	SO1706	ABC-type multidrug transport system, ATPase component
	Sputcn32_1422	SO1707	ABC transporter, permease protein, putative

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD