Statistics of regulated genes

Genome	Genes	Operons
Shewanella oneidensis MR-1	2	2
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3	2	2
Shewanella sp MR-4	2	2
Shewanella sp MR-7	2	2
Shewanella baltica OS155
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B
Shewanella loihica PV-4	2	2
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes																	Function
CRON 1.
SO1392	* Shewanella oneidensis MR-1 Site: position = -203 score = 6.57695 sequence = AGTAGACAAATCAGTCTACT Site: position = -165 score = 5.12244 sequence = TACAGACAAATCTGTCTACT Gene: SO_1392: hypothetical HPP domain-containing protein	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	* Shewanella sp ANA-3 Site: position = -208 score = 6.45926 sequence = GGTAGACAACTCAGTCTACC Site: position = -173 score = 5.92324 sequence = AGCAGACAGATTGGTCTACC Gene: Shewana3_2981: hypothetical HPP domain-containing protein	* Shewanella sp MR-4 Site: position = -208 score = 6.45926 sequence = GGTAGACAACTCAGTCTACT Site: position = -173 score = 5.9957 sequence = GGTAGACAGACTGGTCTACC Gene: Shewmr4_2802: hypothetical HPP domain-containing protein	* Shewanella sp MR-7 Site: position = -208 score = 6.45926 sequence = GGTAGACAACTCAGTCTACT Site: position = -173 score = 5.56991 sequence = AGTAGACAGACTGGTCTACA Gene: Shewmr7_2885: hypothetical HPP domain-containing protein	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	* Shewanella loihica PV-4 Site: position = -97 score = 6.47146 sequence = GGTAGACCAAGTTGTCTACT Site: position = -71 score = 5.74312 sequence = GGTAGACAGACTTGTCTACA Gene: Shew_1680: hypothetical HPP domain-containing protein	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4 Gene: Shal_2211: hypothetical HPP domain-containing protein	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	hypothetical HPP domain-containing protein
CRON 2.
SO1393	* Shewanella oneidensis MR-1 Site: position = -91 score = 6.57695 sequence = AGTAGACTGATTTGTCTACT Site: position = -129 score = 5.12244 sequence = AGTAGACAGATTTGTCTGTA Gene: SO_1393: Transcriptional regulator, TetR family	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	* Shewanella sp ANA-3 Site: position = -98 score = 5.92324 sequence = GGTAGACCAATCTGTCTGCT Site: position = -63 score = 6.45926 sequence = GGTAGACTGAGTTGTCTACC Gene: Shewana3_2980: Transcriptional regulator, TetR family	* Shewanella sp MR-4 Site: position = -63 score = 6.45926 sequence = AGTAGACTGAGTTGTCTACC Site: position = -98 score = 5.9957 sequence = GGTAGACCAGTCTGTCTACC Gene: Shewmr4_2801: Transcriptional regulator, TetR family	* Shewanella sp MR-7 Site: position = -63 score = 6.45926 sequence = AGTAGACTGAGTTGTCTACC Site: position = -98 score = 5.56991 sequence = TGTAGACCAGTCTGTCTACT Gene: Shewmr7_2884: Transcriptional regulator, TetR family	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	* Shewanella loihica PV-4 Site: position = -51 score = 6.47146 sequence = AGTAGACAACTTGGTCTACC Site: position = -77 score = 5.74312 sequence = TGTAGACAAGTCTGTCTACC Gene: Shew_1679: Transcriptional regulator, TetR family	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Transcriptional regulator, TetR family

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD