Regulog SO1393 - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - TetR
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 2 | 2 |
| Shewanella putrefaciens CN-32 | ||
| Shewanella sp W3-18-1 | ||
| Shewanella sp ANA-3 | 2 | 2 |
| Shewanella sp MR-4 | 2 | 2 |
| Shewanella sp MR-7 | 2 | 2 |
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella amazonensis SB2B | ||
| Shewanella loihica PV-4 | 2 | 2 |
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | ||
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| SO1392 |
*
Shewanella oneidensis MR-1 Site: position = -203 score = 6.57695 sequence = AGTAGACAAATCAGTCTACT Site: position = -165 score = 5.12244 sequence = TACAGACAAATCTGTCTACT Gene: SO_1392: hypothetical HPP domain-containing protein |
|
|
*
Shewanella sp ANA-3 Site: position = -208 score = 6.45926 sequence = GGTAGACAACTCAGTCTACC Site: position = -173 score = 5.92324 sequence = AGCAGACAGATTGGTCTACC Gene: Shewana3_2981: hypothetical HPP domain-containing protein |
*
Shewanella sp MR-4 Site: position = -208 score = 6.45926 sequence = GGTAGACAACTCAGTCTACT Site: position = -173 score = 5.9957 sequence = GGTAGACAGACTGGTCTACC Gene: Shewmr4_2802: hypothetical HPP domain-containing protein |
*
Shewanella sp MR-7 Site: position = -208 score = 6.45926 sequence = GGTAGACAACTCAGTCTACT Site: position = -173 score = 5.56991 sequence = AGTAGACAGACTGGTCTACA Gene: Shewmr7_2885: hypothetical HPP domain-containing protein |
|
|
|
|
*
Shewanella loihica PV-4 Site: position = -97 score = 6.47146 sequence = GGTAGACCAAGTTGTCTACT Site: position = -71 score = 5.74312 sequence = GGTAGACAGACTTGTCTACA Gene: Shew_1680: hypothetical HPP domain-containing protein |
|
Gene: Shal_2211: hypothetical HPP domain-containing protein |
|
|
|
hypothetical HPP domain-containing protein |
| CRON 2. | |||||||||||||||||
| SO1393 |
*
Shewanella oneidensis MR-1 Site: position = -91 score = 6.57695 sequence = AGTAGACTGATTTGTCTACT Site: position = -129 score = 5.12244 sequence = AGTAGACAGATTTGTCTGTA Gene: SO_1393: Transcriptional regulator, TetR family |
|
|
*
Shewanella sp ANA-3 Site: position = -98 score = 5.92324 sequence = GGTAGACCAATCTGTCTGCT Site: position = -63 score = 6.45926 sequence = GGTAGACTGAGTTGTCTACC Gene: Shewana3_2980: Transcriptional regulator, TetR family |
*
Shewanella sp MR-4 Site: position = -63 score = 6.45926 sequence = AGTAGACTGAGTTGTCTACC Site: position = -98 score = 5.9957 sequence = GGTAGACCAGTCTGTCTACC Gene: Shewmr4_2801: Transcriptional regulator, TetR family |
*
Shewanella sp MR-7 Site: position = -63 score = 6.45926 sequence = AGTAGACTGAGTTGTCTACC Site: position = -98 score = 5.56991 sequence = TGTAGACCAGTCTGTCTACT Gene: Shewmr7_2884: Transcriptional regulator, TetR family |
|
|
|
|
*
Shewanella loihica PV-4 Site: position = -51 score = 6.47146 sequence = AGTAGACAACTTGGTCTACC Site: position = -77 score = 5.74312 sequence = TGTAGACAAGTCTGTCTACC Gene: Shew_1679: Transcriptional regulator, TetR family |
|
|
|
|
|
Transcriptional regulator, TetR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |