Regulon of SO1393 in Shewanella sp MR-7

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr7_2884
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	SO1393 - Shewanellaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -208 Score: 6.5 Sequence: GGTAGACAACTCAGTCTACT Position: -173 Score: 5.6 Sequence: AGTAGACAGACTGGTCTACA Locus tag: Shewmr7_2885 Name: SO1392 Funciton: hypothetical HPP domain-containing protein
	Shewmr7_2885	SO1392	hypothetical HPP domain-containing protein
Position: -98 Score: 5.6 Sequence: TGTAGACCAGTCTGTCTACT Position: -63 Score: 6.5 Sequence: AGTAGACTGAGTTGTCTACC Locus tag: Shewmr7_2884 Name: SO1393 Funciton: Transcriptional regulator, TetR family
	Shewmr7_2884	SO1393	Transcriptional regulator, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD