Regulon of SO1393 in Shewanella oneidensis MR-1

Properties
Regulator type:	Transcription factor
TF locus tag:	SO_1393
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	SO1393 - Shewanellaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -203 Score: 6.6 Sequence: AGTAGACAAATCAGTCTACT Position: -165 Score: 5.1 Sequence: TACAGACAAATCTGTCTACT Locus tag: SO_1392 Name: SO1392 Funciton: hypothetical HPP domain-containing protein
	SO_1392	SO1392	hypothetical HPP domain-containing protein
Position: -129 Score: 5.1 Sequence: AGTAGACAGATTTGTCTGTA Position: -91 Score: 6.6 Sequence: AGTAGACTGATTTGTCTACT Locus tag: SO_1393 Name: SO1393 Funciton: Transcriptional regulator, TetR family
	SO_1393	SO1393	Transcriptional regulator, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD