Regulog LexA - Alcaligenaceae
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - LexA
- By taxonomy - Alcaligenaceae
- By TF family - LexA
- By effector - DNA damage
- By pathway - SOS response
| Genome | Genes | Operons |
|---|---|---|
| Bordetella avium 197N | 12 | 7 |
| Bordetella bronchiseptica RB50 | 11 | 6 |
| Bordetella petrii DSM 12804 | 11 | 6 |
| Genes | Function | |||
|---|---|---|---|---|
| CRON 1. | ||||
| imuA |
*
Bordetella avium 197N Site: position = -39 score = 6.38455 sequence = TACTGTATATTCATACAGTA Gene: BAV2027: Predicted RecA/RadA recombinase |
*
Bordetella bronchiseptica RB50 Site: position = -35 score = 6.29404 sequence = TACTGTATATTTATACAGTG Gene: BB3086: Predicted RecA/RadA recombinase |
*
Bordetella petrii DSM 12804 Site: position = 60 score = 6.31428 sequence = TACTGTATATTTGTACAGTA Gene: Bpet2611: Predicted RecA/RadA recombinase |
Predicted RecA/RadA recombinase |
| imuB |
Gene: BAV2028: DNA polymerase-like protein PA0670 |
Gene: BB3087: DNA polymerase-like protein PA0670 |
Gene: Bpet2612: DNA polymerase-like protein PA0670 |
DNA polymerase-like protein PA0670 |
| dnaE2 |
Gene: BAV2029: DNA polymerase III alpha subunit (EC 2.7.7.7) |
Gene: BB3088: DNA polymerase III alpha subunit (EC 2.7.7.7) |
Gene: Bpet2613: DNA polymerase III alpha subunit (EC 2.7.7.7) |
DNA polymerase III alpha subunit (EC 2.7.7.7) |
| CRON 2. | ||||
| uvrD |
*
Bordetella avium 197N Site: position = -27 score = 5.72181 sequence = GTCTGTATATATATACAGTG Gene: BAV2545: ATP-dependent DNA helicase II |
*
Bordetella bronchiseptica RB50 Site: position = -41 score = 6.29404 sequence = TTCTGTATAAATATACAGTA Gene: BB1810: ATP-dependent DNA helicase II |
*
Bordetella petrii DSM 12804 Site: position = -6 score = 5.55582 sequence = GTCTGGATGAATATACAGTA Gene: Bpet3400: ATP-dependent DNA helicase II |
ATP-dependent DNA helicase II |
| CRON 3. | ||||
| uvrA |
*
Bordetella avium 197N Site: position = -134 score = 5.83279 sequence = TACTGTTTATCTATACAGCA Gene: BAV2808: Excinuclease ABC subunit A |
*
Bordetella bronchiseptica RB50 Site: position = -150 score = 6.08441 sequence = TACTGTTTATTTATACAGCA Gene: BB4032: Excinuclease ABC subunit A |
*
Bordetella petrii DSM 12804 Site: position = -180 score = 5.66923 sequence = TACTGTTTATATATACAGAT Gene: Bpet0873: Excinuclease ABC subunit A |
Excinuclease ABC subunit A |
| pabB |
Gene: BAV2809: Para-aminobenzoate synthase, aminase component (EC 2.6.1.85) |
Gene: BB4033: Para-aminobenzoate synthase, aminase component (EC 2.6.1.85) |
Gene: Bpet0872: Para-aminobenzoate synthase, aminase component (EC 2.6.1.85) |
Para-aminobenzoate synthase, aminase component (EC 2.6.1.85) |
| pabC |
Gene: BAV2810: Aminodeoxychorismate lyase (EC 4.1.3.38) |
Gene: BB4034: Aminodeoxychorismate lyase (EC 4.1.3.38) |
Gene: Bpet0871: Aminodeoxychorismate lyase (EC 4.1.3.38) |
Aminodeoxychorismate lyase (EC 4.1.3.38) |
| CRON 4. | ||||
| recA |
*
Bordetella avium 197N Site: position = -172 score = 5.83846 sequence = TACTGTTTGTTTGTACAGTA Gene: BAV2309: Recombinase A |
*
Bordetella bronchiseptica RB50 Site: position = -135 score = 5.68144 sequence = CACTGGATTTTTATCCAGTA Gene: BB2076: Recombinase A |
*
Bordetella petrii DSM 12804 Site: position = -136 score = 5.99956 sequence = TACTGGATTTTTATCCAGTA Gene: Bpet2056: Recombinase A |
Recombinase A |
| recX |
Gene: BAV2308: Regulatory protein RecX |
Gene: BB2077: Regulatory protein RecX |
Gene: Bpet2057: Regulatory protein RecX |
Regulatory protein RecX |
| CRON 5. | ||||
| PF4055 |
*
Bordetella avium 197N Site: position = -28 score = 5.7183 sequence = TACTGTGTTTTTGTACAGTA Gene: BAV1370: DNA repair photolyase |
*
Bordetella bronchiseptica RB50 Site: position = -25 score = 5.28428 sequence = TACTGCGTTTTTGTACAGTA Gene: BB3446: DNA repair photolyase |
*
Bordetella petrii DSM 12804 Site: position = -25 score = 5.64596 sequence = TACTGGTTTTTTGTACAGTA Gene: Bpet1911: DNA repair photolyase |
DNA repair photolyase |
| CRON 6. | ||||
| lexA |
*
Bordetella avium 197N Site: position = -62 score = 5.53278 sequence = CGCTGTATATACATACAGTC Gene: BAV1503: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Bordetella bronchiseptica RB50 Site: position = 38 score = 5.21716 sequence = CGCTGTATATCCATACAGTC Gene: BB2271: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Bordetella petrii DSM 12804 Site: position = -39 score = 5.53528 sequence = TGCTGTATATCCATACAGTC Gene: Bpet2782: SOS-response repressor and protease LexA (EC 3.4.21.88) |
SOS-response repressor and protease LexA (EC 3.4.21.88) |
| CRON 7. | ||||
| dinB |
*
Bordetella avium 197N Site: position = -44 score = 5.9442 sequence = TACCGTATATTTATCCAGTA Gene: BAV2034: DNA polymerase IV (EC 2.7.7.7) |
Gene: BB3093: DNA polymerase IV (EC 2.7.7.7) |
Gene: Bpet2618: DNA polymerase IV (EC 2.7.7.7) |
DNA polymerase IV (EC 2.7.7.7) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |