Regulon of LexA in Bordetella bronchiseptica RB50

Properties
Regulator type:	Transcription factor
TF locus tag:	BB2271
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Alcaligenaceae
Statistics of regulated genes:
- Genes	11
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Alcaligenaceae
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -150 Score: 6.1 Sequence: TACTGTTTATTTATACAGCA Locus tag: BB4032 Name: uvrA Funciton: Excinuclease ABC subunit A Locus tag: BB4033 Name: pabB Funciton: Para-aminobenzoate synthase, aminase component (EC 2.6.1.85) Locus tag: BB4034 Name: pabC Funciton: Aminodeoxychorismate lyase (EC 4.1.3.38)
	BB4032	uvrA	Excinuclease ABC subunit A
	BB4033	pabB	Para-aminobenzoate synthase, aminase component (EC 2.6.1.85)
	BB4034	pabC	Aminodeoxychorismate lyase (EC 4.1.3.38)
Position: -41 Score: 6.3 Sequence: TTCTGTATAAATATACAGTA Locus tag: BB1810 Name: uvrD Funciton: ATP-dependent DNA helicase II
	BB1810	uvrD	ATP-dependent DNA helicase II
Position: 38 Score: 5.2 Sequence: CGCTGTATATCCATACAGTC Locus tag: BB2271 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	BB2271	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -35 Score: 6.3 Sequence: TACTGTATATTTATACAGTG Locus tag: BB3086 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: BB3087 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: BB3088 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	BB3086	imuA	Predicted RecA/RadA recombinase
	BB3087	imuB	DNA polymerase-like protein PA0670
	BB3088	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -135 Score: 5.7 Sequence: CACTGGATTTTTATCCAGTA Locus tag: BB2076 Name: recA Funciton: Recombinase A Locus tag: BB2077 Name: recX Funciton: Regulatory protein RecX
	BB2076	recA	Recombinase A
	BB2077	recX	Regulatory protein RecX
Position: -25 Score: 5.3 Sequence: TACTGCGTTTTTGTACAGTA Locus tag: BB3446 Name: PF4055 Funciton: DNA repair photolyase
	BB3446	PF4055	DNA repair photolyase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD