Regulon of LexA in Bordetella avium 197N

Properties
Regulator type:	Transcription factor
TF locus tag:	BAV1503
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Alcaligenaceae
Statistics of regulated genes:
- Genes	12
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Alcaligenaceae
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -134 Score: 5.8 Sequence: TACTGTTTATCTATACAGCA Locus tag: BAV2808 Name: uvrA Funciton: Excinuclease ABC subunit A Locus tag: BAV2809 Name: pabB Funciton: Para-aminobenzoate synthase, aminase component (EC 2.6.1.85) Locus tag: BAV2810 Name: pabC Funciton: Aminodeoxychorismate lyase (EC 4.1.3.38)
	BAV2808	uvrA	Excinuclease ABC subunit A
	BAV2809	pabB	Para-aminobenzoate synthase, aminase component (EC 2.6.1.85)
	BAV2810	pabC	Aminodeoxychorismate lyase (EC 4.1.3.38)
Position: -44 Score: 5.9 Sequence: TACCGTATATTTATCCAGTA Locus tag: BAV2034 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	BAV2034	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -172 Score: 5.8 Sequence: TACTGTTTGTTTGTACAGTA Locus tag: BAV2309 Name: recA Funciton: Recombinase A Locus tag: BAV2308 Name: recX Funciton: Regulatory protein RecX
	BAV2309	recA	Recombinase A
	BAV2308	recX	Regulatory protein RecX
Position: -27 Score: 5.7 Sequence: GTCTGTATATATATACAGTG Locus tag: BAV2545 Name: uvrD Funciton: ATP-dependent DNA helicase II
	BAV2545	uvrD	ATP-dependent DNA helicase II
Position: -39 Score: 6.4 Sequence: TACTGTATATTCATACAGTA Locus tag: BAV2027 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: BAV2028 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: BAV2029 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	BAV2027	imuA	Predicted RecA/RadA recombinase
	BAV2028	imuB	DNA polymerase-like protein PA0670
	BAV2029	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -62 Score: 5.5 Sequence: CGCTGTATATACATACAGTC Locus tag: BAV1503 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	BAV1503	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -28 Score: 5.7 Sequence: TACTGTGTTTTTGTACAGTA Locus tag: BAV1370 Name: PF4055 Funciton: DNA repair photolyase
	BAV1370	PF4055	DNA repair photolyase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD