Regulog HrcA - Chlamydiales
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Chlamydiae |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - HrcA
- By taxonomy - Chlamydiales
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Chlamydia muridarum Nigg | 5 | 2 |
| Chlamydia trachomatis D/UW-3/CX | 5 | 2 |
| Chlamydophila abortus S26/3 | 5 | 2 |
| Chlamydophila felis Fe/C-56 | 5 | 2 |
| Chlamydophila pneumoniae AR39 | 5 | 2 |
| Parachlamydia sp. UWE25 | 5 | 2 |
| Chlamydophila caviae GPIC | 5 | 2 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| hcrA |
*
Chlamydia muridarum Nigg Site: position = -72 score = 5.80511 sequence = CTAGCACTCTTTGCTCGCGAGCGCTAA Gene: TC0673: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Chlamydia trachomatis D/UW-3/CX Site: position = -72 score = 5.99475 sequence = CTAGCACTCTTTAGTTGCGAGCGCTAA Gene: CT394: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Chlamydophila abortus S26/3 Site: position = -101 score = 6.00025 sequence = TTAGCATTCTTTGAGGTTGAGTGCCAA Gene: CAB239: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Chlamydophila felis Fe/C-56 Site: position = -101 score = 6.20308 sequence = TTAGCATTCTTTAGAGGTGAGTGCTAA Gene: CF0763: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Chlamydophila pneumoniae AR39 Site: position = -33 score = 6.56516 sequence = TTAGCATTCATTCAATTCGAGTGCTAA Gene: CP0253: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Parachlamydia sp. UWE25 Site: position = -90 score = 7.19408 sequence = ATAGCACTCGATATAATCGAGTGCTAA Gene: pc1497: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Chlamydophila caviae GPIC Site: position = -101 score = 6.75112 sequence = TTAGCATTCTTTAGAATCGAGTGCTAA Gene: CCA00243: Heat shock response transcriptional regulator HrcA, HrcA family |
Heat shock response transcriptional regulator HrcA, HrcA family |
| grpE |
Gene: TC0674: Heat shock protein GrpE |
Gene: CT395: Heat shock protein GrpE |
Gene: CAB238: Heat shock protein GrpE |
Gene: CF0764: Heat shock protein GrpE |
Gene: CP0252: Heat shock protein GrpE |
Gene: pc1498: Heat shock protein GrpE |
Gene: CCA00242: Heat shock protein GrpE |
Heat shock protein GrpE |
| dnaK |
Gene: TC0675: Chaperone protein DnaK |
Gene: CT396: Chaperone protein DnaK |
Gene: CAB237: Chaperone protein DnaK |
Gene: CF0765: Chaperone protein DnaK |
Gene: CP0251: Chaperone protein DnaK |
Gene: pc1499: Chaperone protein DnaK |
Gene: CCA00241: Chaperone protein DnaK |
Chaperone protein DnaK |
| CRON 2. | ||||||||
| groS |
*
Chlamydia muridarum Nigg Site: position = -161 score = 6.09127 sequence = ATAGCAGTTGAGGTGCTCAACTGCTAA Gene: TC0387: Heat shock protein 60 family co-chaperone GroES |
*
Chlamydia trachomatis D/UW-3/CX Site: position = -161 score = 6.12456 sequence = ATAGCAGTTGATCATGCCAACTGCTAA Gene: CT111: Heat shock protein 60 family co-chaperone GroES |
*
Chlamydophila abortus S26/3 Site: position = -113 score = 6.5831 sequence = ATGGCGCTTGATATTATTAAGTGCTAA Gene: CAB614: Heat shock protein 60 family co-chaperone GroES |
*
Chlamydophila felis Fe/C-56 Site: position = -113 score = 7.24756 sequence = ATAGCACTTGATATTATTAAGTGCTAA Gene: CF0366: Heat shock protein 60 family co-chaperone GroES |
*
Chlamydophila pneumoniae AR39 Site: position = -113 score = 7.1908 sequence = TTAGCACTTAAAATTATTGAGTGCTAA Gene: CP0637: Heat shock protein 60 family co-chaperone GroES |
*
Parachlamydia sp. UWE25 Site: position = -138 score = 6.00218 sequence = TTAGCAATTAAGTTGATTCACTGCTAA Gene: pc1179: Heat shock protein 60 family co-chaperone GroES |
*
Chlamydophila caviae GPIC Site: position = -116 score = 7.06108 sequence = GTAGCACTTGATATTATTAAGTGCTAA Gene: CCA00642: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
Gene: TC0386: Heat shock protein 60 family chaperone GroEL |
Gene: CT110: Heat shock protein 60 family chaperone GroEL |
Gene: CAB615: Heat shock protein 60 family chaperone GroEL |
Gene: CF0365: Heat shock protein 60 family chaperone GroEL |
Gene: CP0638: Heat shock protein 60 family chaperone GroEL |
Gene: pc1180: Heat shock protein 60 family chaperone GroEL |
Gene: CCA00643: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |