Regulon of HrcA in Chlamydophila abortus S26/3

Properties
Regulator type:	Transcription factor
TF locus tag:	CAB239
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Chlamydiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Chlamydiales
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -101 Score: 6 Sequence: TTAGCATTCTTTGAGGTTGAGTGCCAA Locus tag: CAB239 Name: hcrA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: CAB238 Name: grpE Funciton: Heat shock protein GrpE Locus tag: CAB237 Name: dnaK Funciton: Chaperone protein DnaK
	CAB239	hcrA	Heat shock response transcriptional regulator HrcA, HrcA family
	CAB238	grpE	Heat shock protein GrpE
	CAB237	dnaK	Chaperone protein DnaK
Position: -113 Score: 6.6 Sequence: ATGGCGCTTGATATTATTAAGTGCTAA Locus tag: CAB614 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: CAB615 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	CAB614	groS	Heat shock protein 60 family co-chaperone GroES
	CAB615	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD