Regulon of HrcA in Chlamydia trachomatis D/UW-3/CX

Properties
Regulator type:	Transcription factor
TF locus tag:	CT394
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Chlamydiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Chlamydiales
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 6 Sequence: CTAGCACTCTTTAGTTGCGAGCGCTAA Locus tag: CT394 Name: hcrA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: CT395 Name: grpE Funciton: Heat shock protein GrpE Locus tag: CT396 Name: dnaK Funciton: Chaperone protein DnaK
	CT394	hcrA	Heat shock response transcriptional regulator HrcA, HrcA family
	CT395	grpE	Heat shock protein GrpE
	CT396	dnaK	Chaperone protein DnaK
Position: -161 Score: 6.1 Sequence: ATAGCAGTTGATCATGCCAACTGCTAA Locus tag: CT111 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: CT110 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	CT111	groS	Heat shock protein 60 family co-chaperone GroES
	CT110	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD