Regulog ManR2 - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Mannose utilization; Mannosides utilization |
| Effector: | Mannose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - LacI
- By effector - Mannose
- By pathway - Mannose utilization
- By pathway - Mannosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | ||
| Shewanella putrefaciens CN-32 | ||
| Shewanella sp W3-18-1 | ||
| Shewanella sp ANA-3 | ||
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella amazonensis SB2B | 17 | 3 |
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | ||
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| mnnA3 |
|
|
|
|
|
|
|
|
|
*
Shewanella amazonensis SB2B Site: position = -184 score = 6.31665 sequence = AGATGTAATCGATTCCATAA Site: position = -90 score = 6.66299 sequence = AAATGTAATCGATTACAGTG Gene: Sama_0293: Alpha-1,2-mannosidase |
|
|
|
|
|
|
Alpha-1,2-mannosidase |
| manP2 |
|
|
|
|
|
|
|
|
|
Gene: Sama_0292: Predicted mannose transporter, GGP family |
|
|
|
|
|
|
Predicted mannose transporter, GGP family |
| manK2 |
|
|
|
|
|
|
|
|
|
Gene: Sama_0291: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) |
|
|
|
|
|
|
Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) |
| manI2 |
|
|
|
|
|
|
|
|
|
Gene: Sama_0290: D-mannose isomerase (EC 5.3.1.7) |
|
|
|
|
|
|
D-mannose isomerase (EC 5.3.1.7) |
| mnnA4 |
|
|
|
|
|
|
|
|
|
Gene: Sama_0289: Alpha-1,2-mannosidase |
|
|
|
|
|
|
Alpha-1,2-mannosidase |
| mnnA5 |
|
|
|
|
|
|
|
|
|
Gene: Sama_0288: Alpha-1,2-mannosidase |
|
|
|
|
|
|
Alpha-1,2-mannosidase |
| CRON 2. | |||||||||||||||||
| manR2 |
|
|
|
|
|
|
|
|
|
*
Shewanella amazonensis SB2B Site: position = -220 score = 6.66299 sequence = CACTGTAATCGATTACATTT Site: position = -126 score = 6.31665 sequence = TTATGGAATCGATTACATCT Gene: Sama_0294: Transcriptional regulator of mannoside utilization, variant 2, LacI family |
|
|
|
|
|
|
Transcriptional regulator of mannoside utilization, variant 2, LacI family |
| CRON 3. | |||||||||||||||||
| omp(Man) |
|
|
|
|
|
|
|
|
|
*
Shewanella amazonensis SB2B Site: position = -149 score = 6.83908 sequence = CAATGTAATCGATTACATTA Gene: Sama_0295: Mannosides-regulated TonB-dependent outer membrane receptor |
|
|
|
|
|
|
Mannosides-regulated TonB-dependent outer membrane receptor |
| mnnA6 |
|
|
|
|
|
|
|
|
|
Gene: Sama_0296: Alpha-1,2-mannosidase |
|
|
|
|
|
|
Alpha-1,2-mannosidase |
| mnnA7 |
|
|
|
|
|
|
|
|
|
Gene: Sama_0297: Endo-alpha-mannosidase |
|
|
|
|
|
|
Endo-alpha-mannosidase |
| nagK2 |
|
|
|
|
|
|
|
|
|
Gene: Sama_0298: N-acetylglucosamine kinase of eukaryotic type (EC 2.7.1.59) |
|
|
|
|
|
|
N-acetylglucosamine kinase of eukaryotic type (EC 2.7.1.59) |
| Sama_0299 |
|
|
|
|
|
|
|
|
|
Gene: Sama_0299: L-asparaginase (EC 3.5.1.1) |
|
|
|
|
|
|
L-asparaginase (EC 3.5.1.1) |
| ATL |
|
|
|
|
|
|
|
|
|
Gene: Sama_0300: Endo-beta-N-acetylglucosaminidase (EC 3.2.1.96) |
|
|
|
|
|
|
Endo-beta-N-acetylglucosaminidase (EC 3.2.1.96) |
| Sama_0301 |
|
|
|
|
|
|
|
|
|
Gene: Sama_0301: Cytoplasmic copper homeostasis protein cutC |
|
|
|
|
|
|
Cytoplasmic copper homeostasis protein cutC |
| mnnB |
|
|
|
|
|
|
|
|
|
Gene: Sama_0302: Beta-mannosidase (EC 3.2.1.25) |
|
|
|
|
|
|
Beta-mannosidase (EC 3.2.1.25) |
| manP3 |
|
|
|
|
|
|
|
|
|
Gene: Sama_0303: Predicted sodium-dependent mannose transporter |
|
|
|
|
|
|
Predicted sodium-dependent mannose transporter |
| mnnA8 |
|
|
|
|
|
|
|
|
|
Gene: Sama_0304: Alpha-1,2-mannosidase |
|
|
|
|
|
|
Alpha-1,2-mannosidase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |