Profile of regulator ManR2 in Shewanellaceae

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannose utilization; Mannosides utilization
Effector:	Mannose
Regulog:	ManR2 - Shewanellaceae

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - LacI
By effector - Mannose
By pathway - Mannose utilization
By pathway - Mannosides utilization

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Shewanella amazonensis SB2B
	Sama_0294	manR2	-220	6.7	CACTGTAATCGATTACATTT
	Sama_0293	mnnA3	-184	6.3	AGATGTAATCGATTCCATAA
	Sama_0293	mnnA3	-90	6.7	AAATGTAATCGATTACAGTG
	Sama_0294	manR2	-126	6.3	TTATGGAATCGATTACATCT
	Sama_0295	omp(Man)	-149	6.8	CAATGTAATCGATTACATTA

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD