Orthologous regulated operons containing mnnA3 gene

Properties
Regulog:	ManR2 - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannose utilization; Mannosides utilization
Effector:	Mannose
Phylum:	Proteobacteria/gamma

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -184 Score: 6.31665 Sequence: AGATGTAATCGATTCCATAA Position: -90 Score: 6.66299 Sequence: AAATGTAATCGATTACAGTG Locus tag: Sama_0293 Name: mnnA3 Funciton: Alpha-1,2-mannosidase Locus tag: Sama_0292 Name: manP2 Funciton: Predicted mannose transporter, GGP family Locus tag: Sama_0291 Name: manK2 Funciton: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) Locus tag: Sama_0290 Name: manI2 Funciton: D-mannose isomerase (EC 5.3.1.7) Locus tag: Sama_0289 Name: mnnA4 Funciton: Alpha-1,2-mannosidase Locus tag: Sama_0288 Name: mnnA5 Funciton: Alpha-1,2-mannosidase
mnnA3-manP2-manK2-manI2-mnnA4-mnnA5	-184	6.3	AGATGTAATCGATTCCATAA	Sama_0293
	-90	6.7	AAATGTAATCGATTACAGTG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --