Regulog ModE2 - Various betaproteobacteria
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdopterin biosynthesis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - ModE
- By taxonomy - Various betaproteobacteria
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdopterin biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Chromobacterium violaceum ATCC 12472 | ||
| Laribacter hongkongensis HLHK9 | ||
| Neisseria meningitidis MC58 | ||
| Methylobacillus flagellatus KT | 5 | 2 |
| Methylophilales bacterium HTCC2181 | ||
| Methylotenera mobilis JLW8 | 5 | 2 |
| Thiobacillus denitrificans | ||
| Nitrosospira multiformis ATCC 25196 | ||
| Nitrosomonas europaea ATCC 19718 | ||
| Azoarcus sp. EbN1 | ||
| Dechloromonas aromatica RCB | ||
| Thauera sp. MZ1T |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| moaA |
|
|
|
*
Methylobacillus flagellatus KT Site: position = -48 score = 6.01121 sequence = TGTTAGTATTGACCGAAGGACTTACA Gene: Mfla_2294: Molybdenum cofactor biosynthesis protein MoaA |
Gene: MB2181_01935: Molybdenum cofactor biosynthesis protein MoaA |
Gene: Mmol_2036: Molybdenum cofactor biosynthesis protein MoaA |
|
|
|
|
Gene: Daro_1999: Molybdenum cofactor biosynthesis protein MoaA |
|
Molybdenum cofactor biosynthesis protein MoaA |
| mobA |
Gene: CV1625: Molybdopterin-guanine dinucleotide biosynthesis protein MobA |
Gene: LHK_00039: Molybdopterin-guanine dinucleotide biosynthesis protein MobA |
|
Gene: Mfla_2295: Molybdopterin-guanine dinucleotide biosynthesis protein MobA |
Gene: MB2181_01930: Molybdopterin-guanine dinucleotide biosynthesis protein MobA |
Gene: Mmol_2037: Molybdopterin-guanine dinucleotide biosynthesis protein MobA |
|
|
|
|
|
|
Molybdopterin-guanine dinucleotide biosynthesis protein MobA |
| mobB |
|
|
|
Gene: Mfla_2296: Molybdopterin-guanine dinucleotide biosynthesis protein MobB |
Gene: MB2181_01925: Molybdopterin-guanine dinucleotide biosynthesis protein MobB |
|
|
|
|
|
|
|
Molybdopterin-guanine dinucleotide biosynthesis protein MobB |
| moeA |
|
|
|
Gene: Mfla_2297: Molybdopterin biosynthesis protein MoeA |
Gene: MB2181_01920: Molybdopterin biosynthesis protein MoeA |
Gene: Mmol_2038: Molybdopterin biosynthesis protein MoeA |
|
|
|
Gene: ebA1078: Molybdopterin biosynthesis protein MoeA |
|
Gene: Tmz1t_1527: Molybdopterin biosynthesis protein MoeA |
Molybdopterin biosynthesis protein MoeA |
| CRON 2. | |||||||||||||
| Mfla_0622 |
|
|
|
Gene: Mfla_0622: Conserved hypothetical protein |
|
*
Methylotenera mobilis JLW8 Site: position = -139 score = 6.42889 sequence = TGTGATTAAATTGCACATTATTCAAA Gene: Mmol_2127: Conserved hypothetical protein |
|
|
|
|
|
|
Conserved hypothetical protein |
| modA |
|
|
|
|
|
Gene: Mmol_2128: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
Gene: Tbd_1283: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
|
|
Gene: ebA2721: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
|
Gene: Tmz1t_0536: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
| modB |
|
|
|
|
|
Gene: Mmol_2129: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Tbd_1284: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
|
|
Gene: ebA2720: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Daro_2783: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Tmz1t_0537: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
| modC |
|
|
|
|
|
Gene: Mmol_2130: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Tbd_1285: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
|
|
Gene: ebA2719: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Daro_2784: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Tmz1t_0538: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
| CRON 3. | |||||||||||||
| modE2 |
|
|
|
*
Methylobacillus flagellatus KT Site: position = -79 score = 6.01121 sequence = TGTAAGTCCTTCGGTCAATACTAACA Gene: Mfla_2293: Molybdate-responsive transcriptional regulator ModE2, ModE family |
|
*
Methylotenera mobilis JLW8 Site: position = -147 score = 6.42889 sequence = TTTGAATAATGTGCAATTTAATCACA Gene: Mmol_2126: Molybdate-responsive transcriptional regulator ModE2, ModE family |
|
|
|
|
|
|
Molybdate-responsive transcriptional regulator ModE2, ModE family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |