Regulon of ModE2 in Methylotenera mobilis JLW8

Properties
Regulator type:	Transcription factor
TF locus tag:	Mmol_2126
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE2 - Various betaproteobacteria
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Various betaproteobacteria
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -139 Score: 6.4 Sequence: TGTGATTAAATTGCACATTATTCAAA Locus tag: Mmol_2127 Name: Mfla_0622 Funciton: Conserved hypothetical protein Locus tag: Mmol_2128 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: Mmol_2129 Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: Mmol_2130 Name: modC Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	Mmol_2127	Mfla_0622	Conserved hypothetical protein
	Mmol_2128	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	Mmol_2129	modB	Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	Mmol_2130	modC	Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Position: -147 Score: 6.4 Sequence: TTTGAATAATGTGCAATTTAATCACA Locus tag: Mmol_2126 Name: modE2 Funciton: Molybdate-responsive transcriptional regulator ModE2, ModE family
	Mmol_2126	modE2	Molybdate-responsive transcriptional regulator ModE2, ModE family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD