Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing moaA gene

Properties
Regulog: ModE2 - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Phylum: Proteobacteria/Beta
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Methylobacillus flagellatus KT
Position: -48
Score: 6.01121
Sequence: TGTTAGTATTGACCGAAGGACTTACA
Locus tag: Mfla_2294
Name: moaA
Funciton: Molybdenum cofactor biosynthesis protein MoaA
Locus tag: Mfla_2295
Name: mobA
Funciton: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
Locus tag: Mfla_2296
Name: mobB
Funciton: Molybdopterin-guanine dinucleotide biosynthesis protein MobB
Locus tag: Mfla_2297
Name: moeA
Funciton: Molybdopterin biosynthesis protein MoeA
moaA-mobA-mobB-moeA -48 6 TGTTAGTATTGACCGAAGGACTTACA Mfla_2294