Regulon of ModE2 in Methylobacillus flagellatus KT

Properties
Regulator type:	Transcription factor
TF locus tag:	Mfla_2293
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE2 - Various betaproteobacteria
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Various betaproteobacteria
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -79 Score: 6 Sequence: TGTAAGTCCTTCGGTCAATACTAACA Locus tag: Mfla_2293 Name: modE2 Funciton: Molybdate-responsive transcriptional regulator ModE2, ModE family
	Mfla_2293	modE2	Molybdate-responsive transcriptional regulator ModE2, ModE family
Position: -48 Score: 6 Sequence: TGTTAGTATTGACCGAAGGACTTACA Locus tag: Mfla_2294 Name: moaA Funciton: Molybdenum cofactor biosynthesis protein MoaA Locus tag: Mfla_2295 Name: mobA Funciton: Molybdopterin-guanine dinucleotide biosynthesis protein MobA Locus tag: Mfla_2296 Name: mobB Funciton: Molybdopterin-guanine dinucleotide biosynthesis protein MobB Locus tag: Mfla_2297 Name: moeA Funciton: Molybdopterin biosynthesis protein MoeA
	Mfla_2294	moaA	Molybdenum cofactor biosynthesis protein MoaA
	Mfla_2295	mobA	Molybdopterin-guanine dinucleotide biosynthesis protein MobA
	Mfla_2296	mobB	Molybdopterin-guanine dinucleotide biosynthesis protein MobB
	Mfla_2297	moeA	Molybdopterin biosynthesis protein MoeA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD