Statistics of regulated genes

Genome	Genes	Operons
Cupriavidus taiwanensis	6	2
Ralstonia eutropha H16	6	2
Ralstonia eutropha JMP134	6	2
Ralstonia metallidurans CH34	6	2
Ralstonia pickettii 12J	5	2
Ralstonia solanacearum GMI1000	5	2

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes							Function
CRON 1.
tupB	* Cupriavidus taiwanensis Site: position = -31 score = 5.63301 sequence = TTATGTCTGCAAGAACATAA Gene: RALTA_A1003: Tungstate ABC-type transporter, substrate-binding protein	* Ralstonia eutropha H16 Site: position = -37 score = 5.93348 sequence = TTATGTCTGGAAAAACATAA Gene: H16_A1019: Tungstate ABC-type transporter, substrate-binding protein	* Ralstonia eutropha JMP134 Site: position = -35 score = 5.83996 sequence = TTATGTTTATCGAAACATAA Gene: Reut_A0931: Tungstate ABC-type transporter, substrate-binding protein	* Ralstonia metallidurans CH34 Site: position = -35 score = 5.6229 sequence = TTGTGTTTCCAAAAACATAA Gene: Rmet_0895: Tungstate ABC-type transporter, substrate-binding protein	* Ralstonia pickettii 12J Site: position = -52 score = 5.19904 sequence = TCATGCAGCATCCGACATAA Gene: Rpic_2244: Tungstate ABC-type transporter, substrate-binding protein	* Ralstonia solanacearum GMI1000 Site: position = -50 score = 5.19904 sequence = TCATGCAGCATCCGACATAA Gene: RS03658: Tungstate ABC-type transporter, substrate-binding protein	Tungstate ABC-type transporter, substrate-binding protein
CRON 2.
modE3	* Cupriavidus taiwanensis Site: position = -128 score = 5.63301 sequence = TTATGTTCTTGCAGACATAA Gene: RALTA_A1004: Molybdate-responsive transcriptional regulator ModE2	* Ralstonia eutropha H16 Site: position = -127 score = 5.93348 sequence = TTATGTTTTTCCAGACATAA Gene: H16_A1020: Molybdate-responsive transcriptional regulator ModE2	* Ralstonia eutropha JMP134 Site: position = -128 score = 5.83996 sequence = TTATGTTTCGATAAACATAA Gene: Reut_A0932: Molybdate-responsive transcriptional regulator ModE2	* Ralstonia metallidurans CH34 Site: position = -127 score = 5.6229 sequence = TTATGTTTTTGGAAACACAA Gene: Rmet_0896: Molybdate-responsive transcriptional regulator ModE2	* Ralstonia pickettii 12J Site: position = -126 score = 5.19904 sequence = TTATGTCGGATGCTGCATGA Gene: Rpic_2243: Molybdate-responsive transcriptional regulator ModE2	* Ralstonia solanacearum GMI1000 Site: position = -109 score = 5.19904 sequence = TTATGTCGGATGCTGCATGA Gene: RS03657: Molybdate-responsive transcriptional regulator ModE2	Molybdate-responsive transcriptional regulator ModE2
H16_A1021	Cupriavidus taiwanensis Gene: RALTA_A1005: Putative transmembrane protein	Ralstonia eutropha H16 Gene: H16_A1021: Putative transmembrane protein	Ralstonia eutropha JMP134 Gene: Reut_A0933: Putative transmembrane protein	Ralstonia metallidurans CH34 Gene: Rmet_0897: Putative transmembrane protein	Ralstonia pickettii 12J Gene: Rpic_2737: Putative transmembrane protein	Ralstonia solanacearum GMI1000 Gene: RS01138: Putative transmembrane protein	Putative transmembrane protein
H16_A1022	Cupriavidus taiwanensis Gene: RALTA_A1006: Putative ABC-type transporter, permease protein	Ralstonia eutropha H16 Gene: H16_A1022: Putative ABC-type transporter, permease protein	Ralstonia eutropha JMP134 Gene: Reut_A0934: Putative ABC-type transporter, permease protein	Ralstonia metallidurans CH34 Gene: Rmet_0898: Putative ABC-type transporter, permease protein	Ralstonia pickettii 12J Gene: Rpic_2242: Putative ABC-type transporter, permease protein	Ralstonia solanacearum GMI1000 Gene: RS03656: Putative ABC-type transporter, permease protein	Putative ABC-type transporter, permease protein
H16_A1023	Cupriavidus taiwanensis Gene: RALTA_A1007: Putative heme-binding protein	Ralstonia eutropha H16 Gene: H16_A1023: Putative heme-binding protein	Ralstonia eutropha JMP134 Gene: Reut_A0935: Putative heme-binding protein	Ralstonia metallidurans CH34 Gene: Rmet_0899: Putative heme-binding protein	Ralstonia pickettii 12J Gene: Rpic_2241: Putative heme-binding protein	Ralstonia solanacearum GMI1000 Gene: RS03655: Putative heme-binding protein	Putative heme-binding protein
H16_A1024	Cupriavidus taiwanensis Gene: RALTA_A1008: Conserved hypothetical protein, DUF924	Ralstonia eutropha H16 Gene: H16_A1024: Conserved hypothetical protein, DUF924	Ralstonia eutropha JMP134 Gene: Reut_A0936: Conserved hypothetical protein, DUF924	Ralstonia metallidurans CH34 Gene: Rmet_0900: Conserved hypothetical protein, DUF924	Ralstonia pickettii 12J Gene: Rpic_2240: Conserved hypothetical protein, DUF924	Ralstonia solanacearum GMI1000 Gene: RS03654: Conserved hypothetical protein, DUF924	Conserved hypothetical protein, DUF924

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD