Regulon of ModE3 in Ralstonia metallidurans CH34

Properties
Regulator type:	Transcription factor
TF locus tag:	Rmet_0896
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Tungsten homeostasis
Effector:	Tungsten
Regulog:	ModE3 - Ralstonia
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Ralstonia
By TF family - ModE
By effector - Tungsten
By pathway - Tungsten homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 5.6 Sequence: TTGTGTTTCCAAAAACATAA Locus tag: Rmet_0895 Name: tupB Funciton: Tungstate ABC-type transporter, substrate-binding protein
	Rmet_0895	tupB	Tungstate ABC-type transporter, substrate-binding protein
Position: -127 Score: 5.6 Sequence: TTATGTTTTTGGAAACACAA Locus tag: Rmet_0896 Name: modE3 Funciton: Molybdate-responsive transcriptional regulator ModE2 Locus tag: Rmet_0897 Name: H16_A1021 Funciton: Putative transmembrane protein Locus tag: Rmet_0898 Name: H16_A1022 Funciton: Putative ABC-type transporter, permease protein Locus tag: Rmet_0899 Name: H16_A1023 Funciton: Putative heme-binding protein Locus tag: Rmet_0900 Name: H16_A1024 Funciton: Conserved hypothetical protein, DUF924
	Rmet_0896	modE3	Molybdate-responsive transcriptional regulator ModE2
	Rmet_0897	H16_A1021	Putative transmembrane protein
	Rmet_0898	H16_A1022	Putative ABC-type transporter, permease protein
	Rmet_0899	H16_A1023	Putative heme-binding protein
	Rmet_0900	H16_A1024	Conserved hypothetical protein, DUF924

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD