Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing H16_A1023 gene

Properties
Regulog: ModE3 - Ralstonia
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Tungsten homeostasis
Effector: Tungsten
Phylum: Proteobacteria/Beta
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Cupriavidus taiwanensis
Position: -128
Score: 5.63301
Sequence: TTATGTTCTTGCAGACATAA
Locus tag: RALTA_A1004
Name: modE3
Funciton: Molybdate-responsive transcriptional regulator ModE2
Locus tag: RALTA_A1005
Name: H16_A1021
Funciton: Putative transmembrane protein
Locus tag: RALTA_A1006
Name: H16_A1022
Funciton: Putative ABC-type transporter, permease protein
Locus tag: RALTA_A1007
Name: H16_A1023
Funciton: Putative heme-binding protein
Locus tag: RALTA_A1008
Name: H16_A1024
Funciton: Conserved hypothetical protein, DUF924
modE3-H16_A1021-H16_A1022-H16_A1023-H16_A1024 -128 5.6 TTATGTTCTTGCAGACATAA RALTA_A1004
Ralstonia eutropha H16
Position: -127
Score: 5.93348
Sequence: TTATGTTTTTCCAGACATAA
Locus tag: H16_A1020
Name: modE3
Funciton: Molybdate-responsive transcriptional regulator ModE2
Locus tag: H16_A1021
Name: H16_A1021
Funciton: Putative transmembrane protein
Locus tag: H16_A1022
Name: H16_A1022
Funciton: Putative ABC-type transporter, permease protein
Locus tag: H16_A1023
Name: H16_A1023
Funciton: Putative heme-binding protein
Locus tag: H16_A1024
Name: H16_A1024
Funciton: Conserved hypothetical protein, DUF924
modE3-H16_A1021-H16_A1022-H16_A1023-H16_A1024 -127 5.9 TTATGTTTTTCCAGACATAA H16_A1020
Ralstonia eutropha JMP134
Position: -128
Score: 5.83996
Sequence: TTATGTTTCGATAAACATAA
Locus tag: Reut_A0932
Name: modE3
Funciton: Molybdate-responsive transcriptional regulator ModE2
Locus tag: Reut_A0933
Name: H16_A1021
Funciton: Putative transmembrane protein
Locus tag: Reut_A0934
Name: H16_A1022
Funciton: Putative ABC-type transporter, permease protein
Locus tag: Reut_A0935
Name: H16_A1023
Funciton: Putative heme-binding protein
Locus tag: Reut_A0936
Name: H16_A1024
Funciton: Conserved hypothetical protein, DUF924
modE3-H16_A1021-H16_A1022-H16_A1023-H16_A1024 -128 5.8 TTATGTTTCGATAAACATAA Reut_A0932
Ralstonia metallidurans CH34
Position: -127
Score: 5.6229
Sequence: TTATGTTTTTGGAAACACAA
Locus tag: Rmet_0896
Name: modE3
Funciton: Molybdate-responsive transcriptional regulator ModE2
Locus tag: Rmet_0897
Name: H16_A1021
Funciton: Putative transmembrane protein
Locus tag: Rmet_0898
Name: H16_A1022
Funciton: Putative ABC-type transporter, permease protein
Locus tag: Rmet_0899
Name: H16_A1023
Funciton: Putative heme-binding protein
Locus tag: Rmet_0900
Name: H16_A1024
Funciton: Conserved hypothetical protein, DUF924
modE3-H16_A1021-H16_A1022-H16_A1023-H16_A1024 -127 5.6 TTATGTTTTTGGAAACACAA Rmet_0896
Ralstonia pickettii 12J
Position: -126
Score: 5.19904
Sequence: TTATGTCGGATGCTGCATGA
Locus tag: Rpic_2243
Name: modE3
Funciton: Molybdate-responsive transcriptional regulator ModE2
Locus tag: Rpic_2242
Name: H16_A1022
Funciton: Putative ABC-type transporter, permease protein
Locus tag: Rpic_2241
Name: H16_A1023
Funciton: Putative heme-binding protein
Locus tag: Rpic_2240
Name: H16_A1024
Funciton: Conserved hypothetical protein, DUF924
modE3-H16_A1022-H16_A1023-H16_A1024 -126 5.2 TTATGTCGGATGCTGCATGA Rpic_2243
Ralstonia solanacearum GMI1000
Position: -109
Score: 5.19904
Sequence: TTATGTCGGATGCTGCATGA
Locus tag: RS03657
Name: modE3
Funciton: Molybdate-responsive transcriptional regulator ModE2
Locus tag: RS03656
Name: H16_A1022
Funciton: Putative ABC-type transporter, permease protein
Locus tag: RS03655
Name: H16_A1023
Funciton: Putative heme-binding protein
Locus tag: RS03654
Name: H16_A1024
Funciton: Conserved hypothetical protein, DUF924
modE3-H16_A1022-H16_A1023-H16_A1024 -109 5.2 TTATGTCGGATGCTGCATGA RS03657