Orthologous regulated operons containing H16_A1024 gene

Properties
Regulog:	ModE3 - Ralstonia
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Tungsten homeostasis
Effector:	Tungsten
Phylum:	Proteobacteria/Beta

Built upon 12 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cupriavidus taiwanensis
Position: -128 Score: 5.63301 Sequence: TTATGTTCTTGCAGACATAA Locus tag: RALTA_A1004 Name: modE3 Funciton: Molybdate-responsive transcriptional regulator ModE2 Locus tag: RALTA_A1005 Name: H16_A1021 Funciton: Putative transmembrane protein Locus tag: RALTA_A1006 Name: H16_A1022 Funciton: Putative ABC-type transporter, permease protein Locus tag: RALTA_A1007 Name: H16_A1023 Funciton: Putative heme-binding protein Locus tag: RALTA_A1008 Name: H16_A1024 Funciton: Conserved hypothetical protein, DUF924
modE3-H16_A1021-H16_A1022-H16_A1023-H16_A1024	-128	5.6	TTATGTTCTTGCAGACATAA	RALTA_A1004
Ralstonia eutropha H16
Position: -127 Score: 5.93348 Sequence: TTATGTTTTTCCAGACATAA Locus tag: H16_A1020 Name: modE3 Funciton: Molybdate-responsive transcriptional regulator ModE2 Locus tag: H16_A1021 Name: H16_A1021 Funciton: Putative transmembrane protein Locus tag: H16_A1022 Name: H16_A1022 Funciton: Putative ABC-type transporter, permease protein Locus tag: H16_A1023 Name: H16_A1023 Funciton: Putative heme-binding protein Locus tag: H16_A1024 Name: H16_A1024 Funciton: Conserved hypothetical protein, DUF924
modE3-H16_A1021-H16_A1022-H16_A1023-H16_A1024	-127	5.9	TTATGTTTTTCCAGACATAA	H16_A1020
Ralstonia eutropha JMP134
Position: -128 Score: 5.83996 Sequence: TTATGTTTCGATAAACATAA Locus tag: Reut_A0932 Name: modE3 Funciton: Molybdate-responsive transcriptional regulator ModE2 Locus tag: Reut_A0933 Name: H16_A1021 Funciton: Putative transmembrane protein Locus tag: Reut_A0934 Name: H16_A1022 Funciton: Putative ABC-type transporter, permease protein Locus tag: Reut_A0935 Name: H16_A1023 Funciton: Putative heme-binding protein Locus tag: Reut_A0936 Name: H16_A1024 Funciton: Conserved hypothetical protein, DUF924
modE3-H16_A1021-H16_A1022-H16_A1023-H16_A1024	-128	5.8	TTATGTTTCGATAAACATAA	Reut_A0932
Ralstonia metallidurans CH34
Position: -127 Score: 5.6229 Sequence: TTATGTTTTTGGAAACACAA Locus tag: Rmet_0896 Name: modE3 Funciton: Molybdate-responsive transcriptional regulator ModE2 Locus tag: Rmet_0897 Name: H16_A1021 Funciton: Putative transmembrane protein Locus tag: Rmet_0898 Name: H16_A1022 Funciton: Putative ABC-type transporter, permease protein Locus tag: Rmet_0899 Name: H16_A1023 Funciton: Putative heme-binding protein Locus tag: Rmet_0900 Name: H16_A1024 Funciton: Conserved hypothetical protein, DUF924
modE3-H16_A1021-H16_A1022-H16_A1023-H16_A1024	-127	5.6	TTATGTTTTTGGAAACACAA	Rmet_0896
Ralstonia pickettii 12J
Position: -126 Score: 5.19904 Sequence: TTATGTCGGATGCTGCATGA Locus tag: Rpic_2243 Name: modE3 Funciton: Molybdate-responsive transcriptional regulator ModE2 Locus tag: Rpic_2242 Name: H16_A1022 Funciton: Putative ABC-type transporter, permease protein Locus tag: Rpic_2241 Name: H16_A1023 Funciton: Putative heme-binding protein Locus tag: Rpic_2240 Name: H16_A1024 Funciton: Conserved hypothetical protein, DUF924
modE3-H16_A1022-H16_A1023-H16_A1024	-126	5.2	TTATGTCGGATGCTGCATGA	Rpic_2243
Ralstonia solanacearum GMI1000
Position: -109 Score: 5.19904 Sequence: TTATGTCGGATGCTGCATGA Locus tag: RS03657 Name: modE3 Funciton: Molybdate-responsive transcriptional regulator ModE2 Locus tag: RS03656 Name: H16_A1022 Funciton: Putative ABC-type transporter, permease protein Locus tag: RS03655 Name: H16_A1023 Funciton: Putative heme-binding protein Locus tag: RS03654 Name: H16_A1024 Funciton: Conserved hypothetical protein, DUF924
modE3-H16_A1022-H16_A1023-H16_A1024	-109	5.2	TTATGTCGGATGCTGCATGA	RS03657