Regulog ModE - Rhodospirillales

Properties
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Rhodospirillales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Statistics of regulated genes
Genome	Genes	Operons
Acetobacter pasteurianus IFO 3283-01
Azospirillum sp. B510
Gluconacetobacter diazotrophicus PAl 5
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1
Magnetospirillum magneticum AMB-1	5	3
Magnetospirillum magnetotacticum MS-1	5	3
Rhodospirillum centenum SW
Rhodospirillum rubrum ATCC 11170

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
modA	Acetobacter pasteurianus IFO 3283-01	Azospirillum sp. B510	Gluconacetobacter diazotrophicus PAl 5	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	* Magnetospirillum magneticum AMB-1 Site: position = -47 score = 7.03019 sequence = TCGCTATATACATGAACTACATTTCGA Gene: amb2951: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	* Magnetospirillum magnetotacticum MS-1 Site: position = -198 score = 5.80963 sequence = CCGCTATATTGTCGAGATAAATACCGA Site: position = -48 score = 6.72517 sequence = TCGCTATATACCTTAACTACATTTCGT Gene: Magn03010295: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Rhodospirillum centenum SW	Rhodospirillum rubrum ATCC 11170	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modQ1	Acetobacter pasteurianus IFO 3283-01	Azospirillum sp. B510	Gluconacetobacter diazotrophicus PAl 5	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Magnetospirillum magneticum AMB-1	Magnetospirillum magnetotacticum MS-1 Gene: Magn03010294: Predicted molybdenum delivery protein	Rhodospirillum centenum SW	Rhodospirillum rubrum ATCC 11170	Predicted molybdenum delivery protein
modD	Acetobacter pasteurianus IFO 3283-01	Azospirillum sp. B510	Gluconacetobacter diazotrophicus PAl 5	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Magnetospirillum magneticum AMB-1 Gene: amb2953: Molybdenum transport system protein ModD	Magnetospirillum magnetotacticum MS-1 Gene: Magn03010293: Molybdenum transport system protein ModD	Rhodospirillum centenum SW	Rhodospirillum rubrum ATCC 11170	Molybdenum transport system protein ModD
modQ2	Acetobacter pasteurianus IFO 3283-01	Azospirillum sp. B510	Gluconacetobacter diazotrophicus PAl 5	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Magnetospirillum magneticum AMB-1 Gene: amb2952: Predicted molybdenum delivery protein	Magnetospirillum magnetotacticum MS-1	Rhodospirillum centenum SW	Rhodospirillum rubrum ATCC 11170	Predicted molybdenum delivery protein

CRON 2.
modE	Acetobacter pasteurianus IFO 3283-01	Azospirillum sp. B510	Gluconacetobacter diazotrophicus PAl 5	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	* Magnetospirillum magneticum AMB-1 Site: position = -39 score = 5.53171 sequence = TCGTCATATAGTGCGCATACATGACGA Gene: amb2949: Molybdate-responsive transcriptional regulator ModE	* Magnetospirillum magnetotacticum MS-1 Site: position = -10 score = 6.27149 sequence = TCGTAATATAGTGTGGCTACATGACGA Gene: Magn03009350: Molybdate-responsive transcriptional regulator ModE	Rhodospirillum centenum SW	Rhodospirillum rubrum ATCC 11170	Molybdate-responsive transcriptional regulator ModE

CRON 3.
modX	Acetobacter pasteurianus IFO 3283-01	Azospirillum sp. B510	Gluconacetobacter diazotrophicus PAl 5	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	* Magnetospirillum magneticum AMB-1 Site: position = -289 score = 7.03019 sequence = TCGAAATGTAGTTCATGTATATAGCGA Gene: amb2950: Predicted molibdenum binding protein	* Magnetospirillum magnetotacticum MS-1 Site: position = -198 score = 5.80963 sequence = TCGGTATTTATCTCGACAATATAGCGG Gene: Magn03010296: Predicted molibdenum binding protein	Rhodospirillum centenum SW	Rhodospirillum rubrum ATCC 11170	Predicted molibdenum binding protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog ModE - Rhodospirillales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --